Transcript: Human NR_027621.1

Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-04-02
Taxon:
Homo sapiens (human)
Gene:
FHL1 (2273)
Length:
2606
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027621.1
NBCI Gene record:
FHL1 (2273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306157 CGCTGTGGAGGACCAGTATTA pLKO_005 1014 3UTR 100% 13.200 9.240 N Fhl1 n/a
2 TRCN0000117825 AGACCAAGTTTGCCAAGCATT pLKO.1 875 3UTR 100% 4.950 2.970 N FHL1 n/a
3 TRCN0000298273 AGACCAAGTTTGCCAAGCATT pLKO_005 875 3UTR 100% 4.950 2.970 N FHL1 n/a
4 TRCN0000117823 CGTGGATTGCTACAAGAACTT pLKO.1 1038 3UTR 100% 4.950 2.970 N FHL1 n/a
5 TRCN0000287068 CGTGGATTGCTACAAGAACTT pLKO_005 1038 3UTR 100% 4.950 2.970 N FHL1 n/a
6 TRCN0000117822 GCAGTGCTGAAATTCATCCTA pLKO.1 2130 3UTR 100% 3.000 1.800 N FHL1 n/a
7 TRCN0000287067 GCAGTGCTGAAATTCATCCTA pLKO_005 2130 3UTR 100% 3.000 1.800 N FHL1 n/a
8 TRCN0000294456 CTCCAAGGAGGTGCACTATAA pLKO_005 561 3UTR 100% 13.200 6.600 Y FHL1 n/a
9 TRCN0000117824 CTGCCTGAAATGCTTTGACAA pLKO.1 492 3UTR 100% 4.950 2.475 Y FHL1 n/a
10 TRCN0000286999 CTGCCTGAAATGCTTTGACAA pLKO_005 492 3UTR 100% 4.950 2.475 Y FHL1 n/a
11 TRCN0000117826 TGGTGGCCTATGAAGGACAAT pLKO.1 1121 3UTR 100% 4.950 2.475 Y FHL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00567 pDONR223 100% 32.2% None 1_411del;1252_2606del n/a
2 ccsbBroad304_00567 pLX_304 0% 32.2% V5 1_411del;1252_2606del n/a
3 TRCN0000470524 TCCCGGTGTGGCCGGAGATGCCTC pLX_317 38.4% 32.2% V5 1_411del;1252_2606del n/a
Download CSV