Construct: ORF TRCN0000470524
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009299.1_s317c1
- Derived from:
- ccsbBroadEn_00567
- DNA Barcode:
- TCCCGGTGTGGCCGGAGATGCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FHL1 (2273)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470524
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001159700.2 | 100% | 100% | |
| 2 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001159704.1 | 100% | 100% | |
| 3 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001167819.1 | 100% | 100% | |
| 4 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001369329.1 | 100% | 100% | |
| 5 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001369330.1 | 100% | 100% | |
| 6 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001369331.1 | 100% | 100% | |
| 7 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001449.5 | 100% | 100% | |
| 8 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001159699.2 | 94.5% | 94.5% | 1_48del |
| 9 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001159701.2 | 90.6% | 90.6% | 1_87del |
| 10 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001159702.3 | 73.9% | 74.6% | 688_887del;969_970ins71 |
| 11 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001369326.1 | 73.9% | 74.6% | 688_887del;969_970ins71 |
| 12 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001369327.1 | 73.9% | 74.6% | 688_887del;969_970ins71 |
| 13 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001369328.1 | 73.9% | 74.6% | 688_887del;969_970ins71 |
| 14 | human | 2273 | FHL1 | four and a half LIM domains 1 | XM_006724746.3 | 73.9% | 74.6% | 688_887del;969_970ins71 |
| 15 | human | 2273 | FHL1 | four and a half LIM domains 1 | XM_024452354.1 | 73.9% | 74.6% | 688_887del;969_970ins71 |
| 16 | human | 2273 | FHL1 | four and a half LIM domains 1 | XM_006724743.2 | 70.6% | 71% | 1_48del;736_935del;1017_1018ins71 |
| 17 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001159703.2 | 69.2% | 57.8% | 500_501ins187;582_583ins71 |
| 18 | human | 2273 | FHL1 | four and a half LIM domains 1 | NM_001330659.2 | 65.5% | 54.8% | 1_48del;548_549ins187;630_631ins71 |
| 19 | human | 2273 | FHL1 | four and a half LIM domains 1 | NR_027621.1 | 32.2% | 1_411del;1252_2606del | |
| 20 | human | 100128164 | LOC100128164 | four and a half LIM domains... | NR_027622.1 | 12.8% | (many diffs) | |
| 21 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | NM_001287800.1 | 93.6% | 95% | (many diffs) |
| 22 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | NM_010211.3 | 93.6% | 95% | (many diffs) |
| 23 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_017318381.1 | 93.6% | 95% | (many diffs) |
| 24 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | NM_001077362.2 | 88.6% | 89.8% | (many diffs) |
| 25 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527807.2 | 77% | 77.5% | (many diffs) |
| 26 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | NM_001077361.1 | 69.6% | 70.5% | (many diffs) |
| 27 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527800.3 | 69.6% | 70.5% | (many diffs) |
| 28 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527802.1 | 69.6% | 70.5% | (many diffs) |
| 29 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527803.1 | 69.6% | 70.5% | (many diffs) |
| 30 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527804.1 | 69.6% | 70.5% | (many diffs) |
| 31 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527805.2 | 69.6% | 70.5% | (many diffs) |
| 32 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527801.1 | 66.5% | 67.2% | (many diffs) |
| 33 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527808.2 | 64% | 53.7% | (many diffs) |
| 34 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_017318382.1 | 64% | 53.7% | (many diffs) |
| 35 | mouse | 14199 | Fhl1 | four and a half LIM domains 1 | XM_006527809.2 | 60.5% | 50.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 906
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggagaagttt gactgccact actgcaggga tcccttgcag gggaagaagt 121 atgtgcaaaa ggatggccac cactgctgcc tgaaatgctt tgacaagttc tgtgccaaca 181 cctgtgtgga atgccgcaag cccatcggtg cggactccaa ggaggtgcac tataagaacc 241 gcttctggca tgacacctgc ttccgctgtg ccaagtgcct tcaccccttg gccaatgaga 301 cctttgtggc caaggacaac aagatcctgt gcaacaagtg caccactcgg gaggactccc 361 ccaagtgcaa ggggtgcttc aaggccattg tggcaggaga tcaaaacgtg gagtacaagg 421 ggaccgtctg gcacaaagac tgcttcacct gtagtaactg caagcaagtc atcgggactg 481 gaagcttctt ccctaaaggg gaggacttct actgcgtgac ttgccatgag accaagtttg 541 ccaagcattg cgtgaagtgc aacaaggcca tcacatctgg aggaaTCACT TACCAGGATC 601 AGCCCTGGCA TGCCGATTGC TTTGTGTGTG TTACCTGCTC TAAGAAGCTG GCTGGGCAGC 661 GTTTCACCGC TGTGGAGGAC CAGTATTACT GCGTGGATTG CTACAAGAAC TTTGTGGCCA 721 AGAAGTGTGC TGGATGCAAG AACCCCATCA CTGGGTTTGG TAAAGGCTCC AGTGTGGTGG 781 CCTATGAAGG ACAATCCTGG CACGACTACT GCTTCCACTG CAAAAAATGC TCCGTGAATC 841 TGGCCAACAA GCGCTTTGTT TTCCACCAGG AGCAAGTGTA TTGTCCCGAC TGTGCCAAAA 901 AGCTGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATCCCGGTGT GGCCGGAGAT GCCTCACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt