Transcript: Human NR_027671.3

Homo sapiens UDP-glucose glycoprotein glucosyltransferase 1 (UGGT1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
UGGT1 (56886)
Length:
10942
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027671.3
NBCI Gene record:
UGGT1 (56886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423137 ATTCATCAGGTGCCAATTAAA pLKO_005 4717 3UTR 100% 15.000 21.000 N UGGT1 n/a
2 TRCN0000004520 GCAGATATAATTCGTGGCCTT pLKO.1 1742 3UTR 100% 2.160 3.024 N UGGT1 n/a
3 TRCN0000110451 CCCACATTTAAGGAGTTTATA pLKO.1 4228 3UTR 100% 15.000 10.500 N Uggt1 n/a
4 TRCN0000436185 GCTGTTCTTAGAGCATATAAT pLKO_005 1987 3UTR 100% 15.000 10.500 N UGGT1 n/a
5 TRCN0000004523 GCTGAGATGTTCCTTAGTAAT pLKO.1 1888 3UTR 100% 13.200 9.240 N UGGT1 n/a
6 TRCN0000434808 GTGGATGATTATGCTAGATTT pLKO_005 2488 3UTR 100% 13.200 9.240 N UGGT1 n/a
7 TRCN0000004522 CCTGCCAAAGAGATAAGCTAT pLKO.1 2734 3UTR 100% 4.950 3.465 N UGGT1 n/a
8 TRCN0000004521 CCTGTTTACCTCTCTGGCTAT pLKO.1 1051 3UTR 100% 4.050 2.430 N UGGT1 n/a
9 TRCN0000004524 CTCTGTTGGATTTGTACCTCA pLKO.1 5192 3UTR 100% 2.640 1.584 N UGGT1 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6861 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6861 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 9752 3UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8781 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6859 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6859 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6859 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8781 3UTR 100% 5.625 2.813 Y EID2B n/a
18 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 8732 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12783 pDONR223 100% 1.7% None (many diffs) n/a
2 ccsbBroad304_12783 pLX_304 0% 1.7% V5 (many diffs) n/a
3 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 1.7% V5 (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 1.5% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 1.5% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 1.5% V5 (many diffs) n/a
7 ccsbBroadEn_15487 pDONR223 0% 1.4% None (many diffs) n/a
8 ccsbBroad304_15487 pLX_304 0% 1.4% V5 (many diffs) n/a
9 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 1.4% V5 (many diffs) n/a
Download CSV