Transcript: Human NR_027689.1

Homo sapiens ceramide kinase like (CERKL), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
CERKL (375298)
Length:
3030
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027689.1
NBCI Gene record:
CERKL (375298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195687 CTAGAGGCTTGGCACCTAATA pLKO.1 1149 3UTR 100% 13.200 18.480 N CERKL n/a
2 TRCN0000195246 CCAAACGGATATCCTAATAGA pLKO.1 1829 3UTR 100% 5.625 7.875 N CERKL n/a
3 TRCN0000082582 GAGGTCCATATTAGATTGCAT pLKO.1 1430 3UTR 100% 3.000 4.200 N CERKL n/a
4 TRCN0000082579 GCACCTAATACCAGATTAAAT pLKO.1 1160 3UTR 100% 15.000 12.000 N CERKL n/a
5 TRCN0000194705 CAGCTTCCACTTGGCTTAATA pLKO.1 698 3UTR 100% 15.000 10.500 N CERKL n/a
6 TRCN0000082581 GCACATTCTCTTCATGGAGTT pLKO.1 743 3UTR 100% 4.050 2.835 N CERKL n/a
7 TRCN0000082580 CCAAGACTTATCAGTCTTTAT pLKO.1 1451 3UTR 100% 1.320 0.924 N CERKL n/a
8 TRCN0000082578 CGCACTTCTATGAGAATCTAA pLKO.1 1740 3UTR 100% 5.625 3.375 N CERKL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10069 pDONR223 100% 43.3% None (many diffs) n/a
2 TRCN0000476280 GCTCAAACTTGTACCCCAGTTATA pLX_317 18.1% 43.3% V5 (many diffs) n/a
Download CSV