Transcript: Human NR_027690.1

Homo sapiens ceramide kinase like (CERKL), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
CERKL (375298)
Length:
3162
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027690.1
NBCI Gene record:
CERKL (375298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195687 CTAGAGGCTTGGCACCTAATA pLKO.1 1281 3UTR 100% 13.200 18.480 N CERKL n/a
2 TRCN0000195246 CCAAACGGATATCCTAATAGA pLKO.1 1961 3UTR 100% 5.625 7.875 N CERKL n/a
3 TRCN0000082582 GAGGTCCATATTAGATTGCAT pLKO.1 1562 3UTR 100% 3.000 4.200 N CERKL n/a
4 TRCN0000082579 GCACCTAATACCAGATTAAAT pLKO.1 1292 3UTR 100% 15.000 12.000 N CERKL n/a
5 TRCN0000194739 CTGTTGAAGCTTGCAGGAATA pLKO.1 678 3UTR 100% 10.800 8.640 N CERKL n/a
6 TRCN0000194705 CAGCTTCCACTTGGCTTAATA pLKO.1 830 3UTR 100% 15.000 10.500 N CERKL n/a
7 TRCN0000082581 GCACATTCTCTTCATGGAGTT pLKO.1 875 3UTR 100% 4.050 2.835 N CERKL n/a
8 TRCN0000082580 CCAAGACTTATCAGTCTTTAT pLKO.1 1583 3UTR 100% 1.320 0.924 N CERKL n/a
9 TRCN0000082578 CGCACTTCTATGAGAATCTAA pLKO.1 1872 3UTR 100% 5.625 3.375 N CERKL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10069 pDONR223 100% 47.4% None (many diffs) n/a
2 TRCN0000476280 GCTCAAACTTGTACCCCAGTTATA pLX_317 18.1% 47.4% V5 (many diffs) n/a
Download CSV