Transcript: Human NR_028059.1

Homo sapiens PMS1 homolog 2, mismatch repair system component pseudogene 3 (PMS2P3), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
PMS2P3 (5387)
Length:
1518
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028059.1
NBCI Gene record:
PMS2P3 (5387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230064 TAGTCCAGTACAGAACCTGCT pLKO_005 849 3UTR 100% 2.160 1.512 N PMS2P3 n/a
2 TRCN0000230063 TGTCAACATAGTCCAGTACAG pLKO_005 841 3UTR 100% 4.050 2.430 N PMS2P3 n/a
3 TRCN0000118014 GTCAGCGTGAAGCAGTTATTT pLKO.1 1312 3UTR 100% 15.000 7.500 Y PMS2P5 n/a
4 TRCN0000256787 AGTCAGCGTGAAGCAGTTATT pLKO_005 1311 3UTR 100% 13.200 6.600 Y PMS2P9 n/a
5 TRCN0000256790 CTGTGCGCCATAAGGAATTTC pLKO_005 1343 3UTR 100% 13.200 6.600 Y PMS2P9 n/a
6 TRCN0000218389 ATGATTATCACCAAGCCAAAC pLKO_005 749 3UTR 100% 6.000 3.000 Y PMS2P3 n/a
7 TRCN0000107283 CCCTGATGAGAAGATAGCATA pLKO.1 681 3UTR 100% 4.950 2.475 Y PMS2P3 n/a
8 TRCN0000107284 CGGAAGTCAGTCCATCAGATT pLKO.1 891 3UTR 100% 4.950 2.475 Y PMS2P3 n/a
9 TRCN0000107280 GCAGTGAAGGAGTTAGTAGAA pLKO.1 945 3UTR 100% 4.950 2.475 Y PMS2P3 n/a
10 TRCN0000230061 CCAAGCCAAACATCATCATGG pLKO_005 759 3UTR 100% 4.050 2.025 Y PMS2P3 n/a
11 TRCN0000107282 CCGTGGATAATGGAAGGTGAA pLKO.1 814 3UTR 100% 4.050 2.025 Y PMS2P3 n/a
12 TRCN0000230062 TCATCATGGAGTGGAGGTGAA pLKO_005 771 3UTR 100% 4.050 2.025 Y PMS2P3 n/a
13 TRCN0000118012 CCATAAGGAATTTCAAAGGAA pLKO.1 1350 3UTR 100% 3.000 1.500 Y PMS2P5 n/a
14 TRCN0000053031 CCGTGATTGTCAGTTTCCTGA pLKO.1 1408 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
15 TRCN0000174239 CCGTGATTGTCAGTTTCCTGA pLKO.1 1408 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
16 TRCN0000118016 CGACTGGTGTTTGATCACGAT pLKO.1 1243 3UTR 100% 2.640 1.320 Y PMS2P5 n/a
17 TRCN0000107281 GTATGATTATCACCAAGCCAA pLKO.1 747 3UTR 100% 2.640 1.320 Y PMS2P3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11040 pDONR223 100% 33.3% None (many diffs) n/a
2 ccsbBroad304_11040 pLX_304 0% 33.3% V5 (many diffs) n/a
3 TRCN0000477902 TCACAGCCGGGTCATAGTAAATTT pLX_317 76.4% 33.3% V5 (many diffs) n/a
Download CSV