Transcript: Human NR_028346.1

Homo sapiens tripartite motif containing 53A, pseudogene (TRIM53AP), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
TRIM53AP (642569)
Length:
1744
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028346.1
NBCI Gene record:
TRIM53AP (642569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337335 TACCAGCCGCATAGGATTATT pLKO_005 1410 3UTR 100% 0.000 0.000 N TRIM53AP n/a
2 TRCN0000337392 CAGGGTTTCGGAGACATATTA pLKO_005 931 3UTR 100% 15.000 9.000 N TRIM53BP n/a
3 TRCN0000337391 TCCAATTCTGAGTGGATATTA pLKO_005 1043 3UTR 100% 15.000 9.000 N TRIM53BP n/a
4 TRCN0000337395 TTCAGGGTTTCGGAGACATAT pLKO_005 929 3UTR 100% 13.200 7.920 N TRIM53AP n/a
5 TRCN0000218171 ACTTTCACCTCTGGCAAATAT pLKO_005 1198 3UTR 100% 15.000 7.500 Y TRIM49D2 n/a
6 TRCN0000337330 AGGGAGACAAAGAAGATATTC pLKO_005 484 3UTR 100% 13.200 6.600 Y TRIM53BP n/a
7 TRCN0000337397 CCAATTCTGAGTGGATATTAC pLKO_005 1044 3UTR 100% 13.200 6.600 Y TRIM53AP n/a
8 TRCN0000337398 CTGGAAGGATTATGTGAATTT pLKO_005 696 3UTR 100% 13.200 6.600 Y TRIM53AP n/a
9 TRCN0000337332 TCAGCCACTGGAAGGATTATG pLKO_005 689 3UTR 100% 13.200 6.600 Y TRIM53BP n/a
10 TRCN0000337333 ACTGGCAAGACATCCCAATTC pLKO_005 320 3UTR 100% 10.800 5.400 Y TRIM53AP n/a
11 TRCN0000033921 GAATGTGGAAACCACCAGAAT pLKO.1 669 3UTR 100% 4.950 2.475 Y TRIM48 n/a
12 TRCN0000033919 CCCAATTCTTACTCAGTGCTT pLKO.1 333 3UTR 100% 2.640 1.320 Y TRIM48 n/a
13 TRCN0000033920 GAGGAGCAAATGTGTGGCATT pLKO.1 460 3UTR 100% 4.050 2.025 Y TRIM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15934 pDONR223 0% 71.4% None (many diffs) n/a
2 ccsbBroad304_15934 pLX_304 0% 71.4% V5 (many diffs) n/a
3 TRCN0000476541 TCCAAACTTGTCGCGCACACCGTT pLX_317 25.8% 71.4% V5 (many diffs) n/a
4 ccsbBroadEn_03779 pDONR223 100% 71.4% None (many diffs) n/a
5 ccsbBroad304_03779 pLX_304 0% 71.4% V5 (many diffs) n/a
6 TRCN0000479767 CGAAGACGCCTACTTGGGTCTACC pLX_317 25.8% 71.4% V5 (many diffs) n/a
7 ccsbBroadEn_12545 pDONR223 100% 34.1% None (many diffs) n/a
8 ccsbBroad304_12545 pLX_304 0% 34.1% V5 (many diffs) n/a
9 TRCN0000474512 GGGAGGGCCCAAAGGTCCATTTTA pLX_317 79.8% 34.1% V5 (many diffs) n/a
Download CSV