Transcript: Human NR_033290.2

Homo sapiens family with sequence similarity 114 member A1 (FAM114A1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FAM114A1 (92689)
Length:
3555
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033290.2
NBCI Gene record:
FAM114A1 (92689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421352 CCTGGTTAAGCATGCTATATT pLKO_005 1669 3UTR 100% 15.000 21.000 N FAM114A1 n/a
2 TRCN0000135001 CTACGGATTCATGGTGTAAAT pLKO.1 159 3UTR 100% 13.200 18.480 N FAM114A1 n/a
3 TRCN0000424945 GAGGTAACAGCGCGCTGTATT pLKO_005 1038 3UTR 100% 13.200 18.480 N FAM114A1 n/a
4 TRCN0000422927 TGCCTCAATATGTACCATTTA pLKO_005 1417 3UTR 100% 13.200 18.480 N FAM114A1 n/a
5 TRCN0000416024 CAAGAAGGCCGAGGTCCTTAA pLKO_005 1223 3UTR 100% 10.800 8.640 N FAM114A1 n/a
6 TRCN0000175119 CAAACTCAATAAGGCCATGAA pLKO.1 830 3UTR 100% 4.950 3.465 N Fam114a1 n/a
7 TRCN0000137767 GCCCTGGAAATTCTGTCCAAT pLKO.1 591 3UTR 100% 4.950 3.465 N FAM114A1 n/a
8 TRCN0000134196 CAGCTTCATAAAGTAGCAGAA pLKO.1 1062 3UTR 100% 4.050 2.835 N FAM114A1 n/a
9 TRCN0000137455 GAGAAATCTCAAGACCCTCAA pLKO.1 945 3UTR 100% 4.050 2.430 N FAM114A1 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2072 3UTR 100% 4.950 2.475 Y n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2143 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2143 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09347 pDONR223 100% 35.2% None (many diffs) n/a
2 ccsbBroad304_09347 pLX_304 0% 35.2% V5 (many diffs) n/a
3 ccsbBroadEn_09348 pDONR223 100% 35.1% None (many diffs) n/a
4 ccsbBroad304_09348 pLX_304 0% 35.1% V5 (many diffs) n/a
5 TRCN0000474157 GGATTAAATGATAGTTATTCTTAC pLX_317 30% 35.1% V5 (many diffs) n/a
Download CSV