Transcript: Human NR_033500.2

Homo sapiens protein phosphatase 2 scaffold subunit Aalpha (PPP2R1A), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PPP2R1A (5518)
Length:
5251
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033500.2
NBCI Gene record:
PPP2R1A (5518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231599 ACCAGGATGTGGACGTCAAAT pLKO_005 1653 3UTR 100% 13.200 18.480 N PPP2R1A n/a
2 TRCN0000002567 CTCATAGACGAACTCCGCAAT pLKO.1 91 3UTR 100% 4.050 5.670 N PPP2R1A n/a
3 TRCN0000231509 TTGCCAATGTCCGCTTCAATG pLKO_005 1542 3UTR 100% 10.800 8.640 N PPP2R1A n/a
4 TRCN0000231600 ACTGGATCCTGCTGCTGTAAT pLKO_005 1995 3UTR 100% 13.200 9.240 N PPP2R1A n/a
5 TRCN0000231507 CTGGCTTGTGGATCATGTATA pLKO_005 1291 3UTR 100% 13.200 9.240 N PPP2R1A n/a
6 TRCN0000380176 GTTCTTTGATGAGAAACTTAA pLKO_005 1255 3UTR 100% 13.200 9.240 N PPP2R1A n/a
7 TRCN0000381088 ACTGTGTGAACGAGGTGATTG pLKO_005 1110 3UTR 100% 10.800 7.560 N PPP2R1A n/a
8 TRCN0000231508 CTACGCTCTTCTGCATCAATG pLKO_005 1443 3UTR 100% 10.800 7.560 N PPP2R1A n/a
9 TRCN0000010716 CCTGGCTTGTGGATCATGTAT pLKO.1 1290 3UTR 100% 5.625 3.938 N PPP2R1A n/a
10 TRCN0000010718 GACTGTGTGAACGAGGTGATT pLKO.1 1109 3UTR 100% 4.950 3.465 N PPP2R1A n/a
11 TRCN0000010717 ATTTACTTCTCCACCTCCCGT pLKO.1 2031 3UTR 100% 0.660 0.462 N PPP2R1A n/a
12 TRCN0000380757 CCTTCCAGAACCTGATGAAAG pLKO_005 801 3UTR 100% 10.800 6.480 N PPP2R1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01263 pDONR223 100% 31.1% None 1_45del;213_214ins101;1712_5251del n/a
2 ccsbBroad304_01263 pLX_304 0% 31.1% V5 1_45del;213_214ins101;1712_5251del n/a
3 TRCN0000471418 CGAGTTAATCTGGCAATCTATCTT pLX_317 27.3% 31.1% V5 1_45del;213_214ins101;1712_5251del n/a
Download CSV