Transcript: Human NR_033770.1

Homo sapiens Rho associated coiled-coil containing protein kinase 1 pseudogene 1 (ROCK1P1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-02-05
Taxon:
Homo sapiens (human)
Gene:
ROCK1P1 (727758)
Length:
2479
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033770.1
NBCI Gene record:
ROCK1P1 (727758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380344 CACAAAGGCCATGAGTTTATT pLKO_005 553 3UTR 100% 15.000 7.500 Y ROCK1P1 n/a
2 TRCN0000361522 CTACAGGTAGATTAGATTAAT pLKO_005 1128 3UTR 100% 15.000 7.500 Y Rock1 n/a
3 TRCN0000379471 GAAAGCTTAGGTAGATATATT pLKO_005 1179 3UTR 100% 15.000 7.500 Y ROCK1P1 n/a
4 TRCN0000382369 GATAAGAAAGAGGACTTAATT pLKO_005 697 3UTR 100% 15.000 7.500 Y ROCK1P1 n/a
5 TRCN0000195202 CGATCGTCTCTAGGATGATAT pLKO.1 2309 3UTR 100% 13.200 6.600 Y ROCK1 n/a
6 TRCN0000382508 TGTCCATGTAAAGTAAGTTAT pLKO_005 718 3UTR 100% 13.200 6.600 Y ROCK1P1 n/a
7 TRCN0000361455 TGTGGGATGCTACCTGATAAA pLKO_005 971 3UTR 100% 13.200 6.600 Y Rock1 n/a
8 TRCN0000382284 AGTGCCACAGAGATCACTTAG pLKO_005 677 3UTR 100% 10.800 5.400 Y ROCK1P1 n/a
9 TRCN0000381905 CAAGAGATATGCTGCTGTTAG pLKO_005 752 3UTR 100% 10.800 5.400 Y ROCK1P1 n/a
10 TRCN0000194751 CAAATCAGTCTTTCCGGAAAG pLKO.1 890 3UTR 100% 6.000 3.000 Y ROCK1 n/a
11 TRCN0000381663 CCAAACCTCTCTGGCATGTTT pLKO_005 614 3UTR 100% 5.625 2.813 Y ROCK1P1 n/a
12 TRCN0000380568 AGTAAGTTATGATGTAACATC pLKO_005 729 3UTR 100% 4.950 2.475 Y ROCK1P1 n/a
13 TRCN0000379954 GCAAATCAGTCTTTCCGGAAA pLKO_005 889 3UTR 100% 4.050 2.025 Y ROCK1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14921 pDONR223 100% 19.8% None (many diffs) n/a
2 ccsbBroad304_14921 pLX_304 0% 19.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV