Transcript: Human NR_034031.1

Homo sapiens zinc finger protein 839 pseudogene (LOC389906), non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
LOC389906 (389906)
Length:
1791
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_034031.1
NBCI Gene record:
LOC389906 (389906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_034031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195508 CTTGGCGAGAATGCAAAGAAG pLKO.1 1503 3UTR 100% 4.950 3.960 N LOC389906 n/a
2 TRCN0000199077 CGTTGACCTCTTGGCGAGAAT pLKO.1 1494 3UTR 100% 4.950 3.465 N LOC389906 n/a
3 TRCN0000199406 CGCTTGCTTATACGCTGTTGG pLKO.1 1528 3UTR 100% 4.050 2.835 N LOC389906 n/a
4 TRCN0000082363 GCCGACTGTAACATGTTTCAT pLKO.1 904 3UTR 100% 5.625 2.813 Y LOC389906 n/a
5 TRCN0000082365 ACCGTGGGAAAGCAACTAGAA pLKO.1 548 3UTR 100% 4.950 2.475 Y LOC389906 n/a
6 TRCN0000082592 CCTTCAAGACTTCGACACGCT pLKO.1 523 3UTR 100% 0.660 0.330 Y LOC389907 n/a
7 TRCN0000082590 CCGCCTGCCAACCGCCTTCAA pLKO.1 509 3UTR 100% 0.000 0.000 Y LOC389907 n/a
8 TRCN0000199604 GAAGGCGCATTGGCGTCTTGC pLKO.1 230 3UTR 100% 0.000 0.000 Y LOC389906 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_034031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.