Transcript: Human NR_034069.1

Homo sapiens SRSF protein kinase 1 (SRPK1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
SRPK1 (6732)
Length:
4408
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_034069.1
NBCI Gene record:
SRPK1 (6732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_034069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436619 CCCATTAGGACATCCTTTAAA pLKO_005 2397 3UTR 100% 15.000 21.000 N SRPK1 n/a
2 TRCN0000001230 GTGGCAATGAAAGTAGTTAAA pLKO.1 468 3UTR 100% 13.200 18.480 N SRPK1 n/a
3 TRCN0000001232 GAACAACACATTAGCCAACTT pLKO.1 1467 3UTR 100% 4.950 6.930 N SRPK1 n/a
4 TRCN0000416091 CACATATCTGCATGGTATTTG pLKO_005 628 3UTR 100% 13.200 10.560 N SRPK1 n/a
5 TRCN0000432665 TAATCGGATCTGGCTATAATA pLKO_005 1720 3UTR 100% 15.000 10.500 N SRPK1 n/a
6 TRCN0000001231 CAGACCCTAATGATCCAAATA pLKO.1 553 3UTR 100% 13.200 9.240 N SRPK1 n/a
7 TRCN0000194918 CAGACTCTTGTACACCTATAA pLKO.1 1384 3UTR 100% 13.200 9.240 N SRPK1 n/a
8 TRCN0000195047 CATTCAGTGAACAACACATTA pLKO.1 1459 3UTR 100% 13.200 9.240 N SRPK1 n/a
9 TRCN0000199829 GCAGCTGGCTTCACAGATTTC pLKO.1 2019 3UTR 100% 10.800 7.560 N SRPK1 n/a
10 TRCN0000197066 GCTGAAGTCAGTTCGCAATTC pLKO.1 533 3UTR 100% 10.800 7.560 N SRPK1 n/a
11 TRCN0000427696 TTGAATCAGGAATCTAGTTTC pLKO_005 1323 3UTR 100% 10.800 7.560 N SRPK1 n/a
12 TRCN0000423220 TTTCTAGTGCATATCCTATTG pLKO_005 2495 3UTR 100% 10.800 7.560 N SRPK1 n/a
13 TRCN0000001229 CCAGGCAGAATTACTAGAGAA pLKO.1 983 3UTR 100% 4.950 3.465 N SRPK1 n/a
14 TRCN0000196475 GCATTGATCATAGAACTTCTG pLKO.1 1851 3UTR 100% 4.050 2.835 N SRPK1 n/a
15 TRCN0000001228 CCATAACTAAAGGATCAGGAT pLKO.1 2969 3UTR 100% 2.640 1.848 N SRPK1 n/a
16 TRCN0000417529 ATGTACAGCAGAGACATTAAA pLKO_005 2555 3UTR 100% 15.000 9.000 N SRPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_034069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487853 CAACTATGGACGGGAACTAGTAAC pLX_317 15.8% 44.5% V5 (not translated due to prior stop codon) 1_124del;199_226del;2118_4408del n/a
2 ccsbBroadEn_06998 pDONR223 100% 44.5% None (many diffs) n/a
3 ccsbBroad304_06998 pLX_304 0% 44.5% V5 (many diffs) n/a
4 TRCN0000471138 AGGTCATAATAACTGTTCTGGTAC pLX_317 20.4% 44.5% V5 (many diffs) n/a
5 ccsbBroadEn_14846 pDONR223 0% 44.5% None (many diffs) n/a
6 ccsbBroad304_14846 pLX_304 0% 44.5% V5 (many diffs) n/a
7 TRCN0000480505 GATACTGGCAAAGGGAAACGCTCA pLX_317 21% 44.5% V5 (many diffs) n/a
Download CSV