Transcript: Human NR_034152.1

Homo sapiens NOL4L divergent transcript (NOL4L-DT), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
NOL4L-DT (149950)
Length:
867
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_034152.1
NBCI Gene record:
NOL4L-DT (149950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_034152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163944 CAGCAGTGACAACTGTGTTAT pLKO.1 424 3UTR 100% 13.200 9.240 N NOL4L-DT n/a
2 TRCN0000164637 GCAGTGACAACTGTGTTATGA pLKO.1 426 3UTR 100% 5.625 3.938 N NOL4L-DT n/a
3 TRCN0000163666 CTGTGTTATGAAGCACCTACT pLKO.1 436 3UTR 100% 4.050 2.835 N NOL4L-DT n/a
4 TRCN0000162029 CAAGAATGGAACAAGAAGACA pLKO.1 469 3UTR 100% 3.000 2.100 N NOL4L-DT n/a
5 TRCN0000165746 CTCCCTGCTTTCTTTGTCTGT pLKO.1 677 3UTR 100% 2.640 1.848 N NOL4L-DT n/a
6 TRCN0000163325 CTGCTTTCTTTGTCTGTCTCA pLKO.1 681 3UTR 100% 2.640 1.584 N NOL4L-DT n/a
7 TRCN0000166281 CAAGAAGACATGCTTTGCCCT pLKO.1 480 3UTR 100% 0.660 0.396 N NOL4L-DT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_034152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10559 pDONR223 100% 48.3% None 1_232del;622A>G;653_867del n/a
2 ccsbBroad304_10559 pLX_304 0% 48.3% V5 1_232del;622A>G;653_867del n/a
3 TRCN0000474849 CCAATAGCCAGCCCCACTTTGCAC pLX_317 72.6% 48.3% V5 1_232del;622A>G;653_867del n/a
Download CSV