Transcript: Human NR_037641.2

Homo sapiens MROH7-TTC4 readthrough (NMD candidate) (MROH7-TTC4), transcript variant 3, long non-coding RNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
MROH7-TTC4 (100527960)
Length:
6132
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037641.2
NBCI Gene record:
MROH7-TTC4 (100527960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218907 ATAGGATTCCAAGGCTTTAAA pLKO_005 5402 3UTR 100% 15.000 7.500 Y TTC4 n/a
2 TRCN0000230854 GAACAGGCCAAGACCTATAAA pLKO_005 4158 3UTR 100% 15.000 7.500 Y TTC4 n/a
3 TRCN0000144932 GCCACCTCAAAGCAATAATAA pLKO.1 4375 3UTR 100% 15.000 7.500 Y TTC4 n/a
4 TRCN0000145404 GCTTGTCTCCAGTCAATTATT pLKO.1 4113 3UTR 100% 15.000 7.500 Y TTC4 n/a
5 TRCN0000230853 GGCTTGTCTCCAGTCAATTAT pLKO_005 4112 3UTR 100% 15.000 7.500 Y TTC4 n/a
6 TRCN0000230855 ATGAGGGCAATGATTACTTTA pLKO_005 4180 3UTR 100% 13.200 6.600 Y TTC4 n/a
7 TRCN0000230856 CAGGTTTATTGATCATCTAAT pLKO_005 4718 3UTR 100% 13.200 6.600 Y TTC4 n/a
8 TRCN0000142803 CCACATCTTGCTCTGCATTTA pLKO.1 5518 3UTR 100% 13.200 6.600 Y TTC4 n/a
9 TRCN0000143823 GCACCAGAGGTACTTTGTAAA pLKO.1 4877 3UTR 100% 13.200 6.600 Y TTC4 n/a
10 TRCN0000122779 GCCACATCTTGCTCTGCATTT pLKO.1 5517 3UTR 100% 10.800 5.400 Y TTC4 n/a
11 TRCN0000143131 CCTGGCCTCAAGTTATTTCAT pLKO.1 5433 3UTR 100% 5.625 2.813 Y TTC4 n/a
12 TRCN0000157045 GCTCAACATGGGCTCAAGAAA pLKO.1 989 3UTR 100% 5.625 2.813 Y MROH7 n/a
13 TRCN0000143132 CCATCTGGAACTGAAACACTT pLKO.1 4409 3UTR 100% 4.950 2.475 Y TTC4 n/a
14 TRCN0000153997 CCCTCAGTCAAATTCTGAAGA pLKO.1 770 3UTR 100% 4.950 2.475 Y MROH7 n/a
15 TRCN0000151708 CCTCAGTCAAATTCTGAAGAT pLKO.1 771 3UTR 100% 4.950 2.475 Y MROH7 n/a
16 TRCN0000153055 GATCGAGGAATTTGGAGACTT pLKO.1 2397 3UTR 100% 4.950 2.475 Y MROH7 n/a
17 TRCN0000152962 GTGTTGAACCACATGCTTCTA pLKO.1 2103 3UTR 100% 4.950 2.475 Y MROH7 n/a
18 TRCN0000152458 CATGCTTCTAACTCTGCCTTT pLKO.1 2114 3UTR 100% 4.050 2.025 Y MROH7 n/a
19 TRCN0000153914 CCTTTGATGAAGTGACCTCAT pLKO.1 1573 3UTR 100% 4.050 2.025 Y MROH7 n/a
20 TRCN0000144701 GCAATAATAAGAGGTGCCTTA pLKO.1 4386 3UTR 100% 4.050 2.025 Y TTC4 n/a
21 TRCN0000142535 GCACAGTACTATCTGGGCAAT pLKO.1 4305 3UTR 100% 4.050 2.025 Y TTC4 n/a
22 TRCN0000142556 GCTTCTGGAAATGAGGGCTAA pLKO.1 4487 3UTR 100% 4.050 2.025 Y TTC4 n/a
23 TRCN0000122196 GAAAGGTGTACCAGATACGAT pLKO.1 4966 3UTR 100% 3.000 1.500 Y TTC4 n/a
24 TRCN0000158088 CCTGAAGAACATGGATGGGAT pLKO.1 3501 3UTR 100% 2.640 1.320 Y MROH7 n/a
25 TRCN0000142847 CCTGATTTGAATGCTGTCCTT pLKO.1 4266 3UTR 100% 2.640 1.320 Y TTC4 n/a
26 TRCN0000153841 CTATGTTGAATCTGCTCCCAA pLKO.1 472 3UTR 100% 2.640 1.320 Y MROH7 n/a
27 TRCN0000156403 GCATGACTCTAATCCTGGGTT pLKO.1 1315 3UTR 100% 2.640 1.320 Y MROH7 n/a
28 TRCN0000153195 GCTATATGAGAGCAACAAGCA pLKO.1 2325 3UTR 100% 2.640 1.320 Y MROH7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07106 pDONR223 100% 16.3% None (many diffs) n/a
2 ccsbBroad304_07106 pLX_304 0% 16.3% V5 (many diffs) n/a
3 TRCN0000473972 GGCACTCGGCTATTACTAGTGACG pLX_317 50.8% 16.3% V5 (many diffs) n/a
Download CSV