Transcript: Human NR_040585.1

Homo sapiens stromal antigen 3-like 4 (pseudogene) (STAG3L4), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
STAG3L4 (64940)
Length:
2219
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_040585.1
NBCI Gene record:
STAG3L4 (64940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_040585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431714 TTACTACCACTTCACAATTTA pLKO_005 1246 3UTR 100% 15.000 21.000 N STAG3L4 n/a
2 TRCN0000425680 TACTATCACGTAGGCTCATAG pLKO_005 1153 3UTR 100% 10.800 15.120 N STAG3L4 n/a
3 TRCN0000161216 GCTGCTTAATCATACGTCAAA pLKO.1 1898 3UTR 100% 4.950 6.930 N STAG3L4 n/a
4 TRCN0000426399 GAAAGGTGTGTAGTGACTATG pLKO_005 1008 3UTR 100% 10.800 8.640 N STAG3L4 n/a
5 TRCN0000429187 GCCATAGACACCATTACTATC pLKO_005 1139 3UTR 100% 10.800 8.640 N STAG3L4 n/a
6 TRCN0000434766 ACTACATTGTCAAAGACAAAG pLKO_005 789 3UTR 100% 10.800 7.560 N STAG3L4 n/a
7 TRCN0000426744 GTCTGCACGAAGATATCAATC pLKO_005 672 3UTR 100% 10.800 7.560 N STAG3L4 n/a
8 TRCN0000162429 CATCTGATCTTGTGGATGTAA pLKO.1 323 3UTR 100% 5.625 3.938 N STAG3L4 n/a
9 TRCN0000159004 GCTCATTAGTAATCCATCATT pLKO.1 1528 3UTR 100% 5.625 3.938 N STAG3L4 n/a
10 TRCN0000166573 CAGTACATCCTCCTCCATGAT pLKO.1 518 3UTR 100% 4.950 3.465 N STAG3L4 n/a
11 TRCN0000165786 CCTCCATGATGACTTCCCTAT pLKO.1 529 3UTR 100% 4.050 2.835 N STAG3L4 n/a
12 TRCN0000161179 GATATCAATCAGCGTCAGTAT pLKO.1 683 3UTR 100% 4.950 2.970 N STAG3L4 n/a
13 TRCN0000430056 AGTACTCTGCAAGGCTAATTA pLKO_005 951 3UTR 100% 15.000 7.500 Y STAG3L4 n/a
14 TRCN0000423018 GCTAATTAGGACAGATCAATG pLKO_005 964 3UTR 100% 10.800 5.400 Y STAG3L4 n/a
15 TRCN0000137748 GCAGGATTTCTGGAGCTTGTT pLKO.1 294 3UTR 100% 4.950 2.475 Y STAG3 n/a
16 TRCN0000165549 GATGCAGGATTTCTGGAGCTT pLKO.1 291 3UTR 100% 2.640 1.320 Y STAG3L4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_040585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03986 pDONR223 100% 20.2% None 1_258del;344_419del;785_2219del n/a
2 ccsbBroad304_03986 pLX_304 0% 20.2% V5 1_258del;344_419del;785_2219del n/a
3 TRCN0000469741 AGGAAACCCGCCGAGAAACTTGGA pLX_317 75.9% 20.2% V5 1_258del;344_419del;785_2219del n/a
Download CSV