Transcript: Human NR_040718.2

Homo sapiens Ras association domain family member 3 (RASSF3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RASSF3 (283349)
Length:
3269
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_040718.2
NBCI Gene record:
RASSF3 (283349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_040718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077898 CGCCTTTCTATCTGTAGATTT pLKO.1 726 3UTR 100% 13.200 18.480 N RASSF3 n/a
2 TRCN0000423451 CATCCACTCTACCTGCGTTTG pLKO_005 387 3UTR 100% 6.000 4.800 N RASSF3 n/a
3 TRCN0000077899 CGGCCAACAAGATGTTGAGAA pLKO.1 240 3UTR 100% 4.950 3.465 N RASSF3 n/a
4 TRCN0000077902 GAGATCAAAGAGAAAGTTCAT pLKO.1 295 3UTR 100% 4.950 3.465 N RASSF3 n/a
5 TRCN0000431608 TAGCAGTCACAGACAAGTTGA pLKO_005 326 3UTR 100% 4.950 3.465 N RASSF3 n/a
6 TRCN0000417538 AGAACCTGAAGAGGCGCTACA pLKO_005 541 3UTR 100% 4.050 2.835 N RASSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_040718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09941 pDONR223 100% 13.5% None (many diffs) n/a
2 ccsbBroad304_09941 pLX_304 0% 13.5% V5 (many diffs) n/a
3 TRCN0000477958 ACATATCTGCATCAGTTGGTCCTC pLX_317 66.7% 13.5% V5 (many diffs) n/a
4 ccsbBroadEn_13498 pDONR223 100% 11.5% None (many diffs) n/a
5 ccsbBroad304_13498 pLX_304 0% 11.5% V5 (many diffs) n/a
6 TRCN0000481294 GAGGTCCCAGATATCTCGGGACAC pLX_317 98.8% 11.5% V5 (many diffs) n/a
Download CSV