Transcript: Human NR_045286.2

Homo sapiens PTPRF interacting protein alpha 1 (PPFIA1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PPFIA1 (8500)
Length:
6167
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045286.2
NBCI Gene record:
PPFIA1 (8500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380097 GGTGTTTCCGAGACGGATAAC pLKO_005 2727 3UTR 100% 10.800 15.120 N PPFIA1 n/a
2 TRCN0000342461 TGAGCCTTCCAAGGTACAAAC pLKO_005 1901 3UTR 100% 10.800 15.120 N PPFIA1 n/a
3 TRCN0000342517 GAGTTCGCAGCACTTACTAAA pLKO_005 490 3UTR 100% 13.200 10.560 N PPFIA1 n/a
4 TRCN0000380570 AGATCTTCTGATGGTTCTTTA pLKO_005 934 3UTR 100% 13.200 9.240 N PPFIA1 n/a
5 TRCN0000342516 GATGACAAGACAACCATAAAG pLKO_005 2427 3UTR 100% 13.200 9.240 N PPFIA1 n/a
6 TRCN0000380824 AGCCATGTGCATTATCCTTTA pLKO_005 4303 3UTR 100% 10.800 7.560 N PPFIA1 n/a
7 TRCN0000002971 GCACAGTTGGAGGAGAAGAAT pLKO.1 1486 3UTR 100% 5.625 3.938 N PPFIA1 n/a
8 TRCN0000002968 GCTCCAAGAAATCATAAGTAA pLKO.1 987 3UTR 100% 5.625 3.938 N PPFIA1 n/a
9 TRCN0000002970 GCATATTAACAAGCCAGCAAA pLKO.1 4982 3UTR 100% 4.950 3.465 N PPFIA1 n/a
10 TRCN0000002967 GTAGTTTGTTAGAAGAGGAAT pLKO.1 791 3UTR 100% 4.950 3.465 N PPFIA1 n/a
11 TRCN0000002969 GAGGAGATTGAAAGTCGAGTT pLKO.1 2178 3UTR 100% 4.050 2.835 N PPFIA1 n/a
12 TRCN0000342514 GAGGAGATTGAAAGTCGAGTT pLKO_005 2178 3UTR 100% 4.050 2.835 N PPFIA1 n/a
13 TRCN0000251544 ATGTATATCCAGGCTATAAAT pLKO_005 4101 3UTR 100% 15.000 9.000 N Ppfia1 n/a
14 TRCN0000342548 ATGTATATCCAGGCTATAAAT pLKO_005 4101 3UTR 100% 15.000 9.000 N PPFIA1 n/a
15 TRCN0000380944 CAGAGATCCAGCGTGAGATTG pLKO_005 2986 3UTR 100% 10.800 6.480 N PPFIA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07248 pDONR223 100% 57.8% None (many diffs) n/a
2 ccsbBroad304_07248 pLX_304 0% 57.8% V5 (many diffs) n/a
3 TRCN0000492109 GCCTACGAGACGTCTGAGGCGCCA pLX_317 9.8% 57.8% V5 (many diffs) n/a
Download CSV