Transcript: Human NR_046297.1

Homo sapiens PMS1 homolog 2, mismatch repair system component pseudogene 4 (PMS2P4), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
PMS2P4 (5382)
Length:
759
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046297.1
NBCI Gene record:
PMS2P4 (5382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118014 GTCAGCGTGAAGCAGTTATTT pLKO.1 410 3UTR 100% 15.000 7.500 Y PMS2P5 n/a
2 TRCN0000256787 AGTCAGCGTGAAGCAGTTATT pLKO_005 409 3UTR 100% 13.200 6.600 Y PMS2P9 n/a
3 TRCN0000256786 TTCTAGATGATCTGCACAAAT pLKO_005 661 3UTR 100% 13.200 6.600 Y PMS2P9 n/a
4 TRCN0000107284 CGGAAGTCAGTCCATCAGATT pLKO.1 102 3UTR 100% 4.950 2.475 Y PMS2P3 n/a
5 TRCN0000118012 CCATAAGGAATTTCAAAGGAA pLKO.1 448 3UTR 100% 3.000 1.500 Y PMS2P5 n/a
6 TRCN0000053031 CCGTGATTGTCAGTTTCCTGA pLKO.1 506 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
7 TRCN0000174239 CCGTGATTGTCAGTTTCCTGA pLKO.1 506 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
8 TRCN0000118016 CGACTGGTGTTTGATCACGAT pLKO.1 341 3UTR 100% 2.640 1.320 Y PMS2P5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11040 pDONR223 100% 31.9% None (many diffs) n/a
2 ccsbBroad304_11040 pLX_304 0% 31.9% V5 (many diffs) n/a
3 TRCN0000477902 TCACAGCCGGGTCATAGTAAATTT pLX_317 76.4% 31.9% V5 (many diffs) n/a
Download CSV