Transcript: Human NR_046382.2

Homo sapiens zinc finger protein 195 (ZNF195), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
ZNF195 (7748)
Length:
3157
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046382.2
NBCI Gene record:
ZNF195 (7748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235735 ATAGGCAAAGCCGTTAGTATC pLKO_005 1990 3UTR 100% 10.800 15.120 N ZNF195 n/a
2 TRCN0000235733 GAAATTGTGGCCTTGATAATT pLKO_005 603 3UTR 100% 15.000 10.500 N ZNF195 n/a
3 TRCN0000235732 GAATGTAACAACGTCATTAAA pLKO_005 986 3UTR 100% 15.000 10.500 N ZNF195 n/a
4 TRCN0000013023 CCAGAGCACACAAGAGTATTT pLKO.1 2103 3UTR 100% 13.200 9.240 N ZNF195 n/a
5 TRCN0000235734 GCAACATCTTTAAGCAGTTAT pLKO_005 1575 3UTR 100% 13.200 9.240 N ZNF195 n/a
6 TRCN0000235731 TTACTGAACCTGAGAACATTG pLKO_005 936 3UTR 100% 10.800 7.560 N ZNF195 n/a
7 TRCN0000013027 CAAGAATGTAACAACGTCATT pLKO.1 983 3UTR 100% 4.950 3.465 N ZNF195 n/a
8 TRCN0000013025 CCTTTCTAATCAACAGATGAT pLKO.1 1180 3UTR 100% 4.950 3.465 N ZNF195 n/a
9 TRCN0000013026 GCAGTTATCAGACCTCACTAA pLKO.1 1588 3UTR 100% 4.950 3.465 N ZNF195 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1794 3UTR 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1794 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1794 3UTR 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 309 3UTR 100% 5.625 2.813 Y ZNF765 n/a
14 TRCN0000430017 CCAGTCCTCAAACCTTATTAA pLKO_005 1840 3UTR 100% 15.000 7.500 Y ZNF431 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15625 pDONR223 0% 52.8% None 1_293del;294_295insT;1964_3157del n/a
2 ccsbBroad304_15625 pLX_304 0% 52.8% V5 1_293del;294_295insT;1964_3157del n/a
3 ccsbBroadEn_07172 pDONR223 100% 50.4% None (many diffs) n/a
4 ccsbBroad304_07172 pLX_304 0% 50.4% V5 (many diffs) n/a
Download CSV