Transcript: Human NR_046476.2

Homo sapiens DIS3 like 3'-5' exoribonuclease 2 (DIS3L2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DIS3L2 (129563)
Length:
3293
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046476.2
NBCI Gene record:
DIS3L2 (129563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120757 GCTCGTAATAGAGCCTTAAAT pLKO.1 447 3UTR 100% 15.000 21.000 N Dis3l2 n/a
2 TRCN0000158942 GCTCGTAATAGAGCCTTAAAT pLKO.1 447 3UTR 100% 15.000 21.000 N DIS3L2 n/a
3 TRCN0000164413 CGGATGGTGATCGAGACATTT pLKO.1 409 3UTR 100% 13.200 18.480 N DIS3L2 n/a
4 TRCN0000164255 CGTCTTGAATCTCCACGGAAT pLKO.1 1730 3UTR 100% 4.050 5.670 N DIS3L2 n/a
5 TRCN0000120759 TGCTCGTAATAGAGCCTTAAA pLKO.1 446 3UTR 100% 13.200 10.560 N Dis3l2 n/a
6 TRCN0000158536 CAGGGTGTATTGAGAATTAAT pLKO.1 354 3UTR 100% 15.000 10.500 N DIS3L2 n/a
7 TRCN0000158458 CCAGGGTGTATTGAGAATTAA pLKO.1 353 3UTR 100% 15.000 10.500 N DIS3L2 n/a
8 TRCN0000162370 CCTCAAACTCTTGGCTGATAA pLKO.1 896 3UTR 100% 13.200 9.240 N DIS3L2 n/a
9 TRCN0000160005 CCTCAAGGATGTCATATCTAT pLKO.1 1845 3UTR 100% 5.625 3.938 N DIS3L2 n/a
10 TRCN0000159538 CCAAACATTTGGAGATGACAA pLKO.1 2008 3UTR 100% 4.950 3.465 N DIS3L2 n/a
11 TRCN0000158866 GAAGGAATACTAACAGAGTAT pLKO.1 1146 3UTR 100% 0.495 0.347 N DIS3L2 n/a
12 TRCN0000120761 CCAGAGAGCAATGACAAAGAA pLKO.1 522 3UTR 100% 5.625 3.375 N Dis3l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13145 pDONR223 100% 55.6% None (many diffs) n/a
2 ccsbBroad304_13145 pLX_304 0% 55.6% V5 (many diffs) n/a
3 TRCN0000473439 GATGTAGTATCCAACTTCATTTTG pLX_317 21.7% 55.6% V5 (many diffs) n/a
Download CSV