Construct: ORF TRCN0000473439
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006673.1_s317c1
- Derived from:
- ccsbBroadEn_13145
- DNA Barcode:
- GATGTAGTATCCAACTTCATTTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DIS3L2 (129563)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473439
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 129563 | DIS3L2 | DIS3 like 3'-5' exoribonucl... | NM_001257281.2 | 88.1% | 79.1% | (many diffs) |
| 2 | human | 129563 | DIS3L2 | DIS3 like 3'-5' exoribonucl... | NM_152383.4 | 69% | 62.6% | (many diffs) |
| 3 | human | 129563 | DIS3L2 | DIS3 like 3'-5' exoribonucl... | NR_046476.2 | 55.6% | (many diffs) | |
| 4 | human | 129563 | DIS3L2 | DIS3 like 3'-5' exoribonucl... | NR_046477.2 | 43.3% | (many diffs) | |
| 5 | human | 129563 | DIS3L2 | DIS3 like 3'-5' exoribonucl... | NM_001257282.1 | 37.8% | 36.9% | (many diffs) |
| 6 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | NM_153530.2 | 60.8% | 55.2% | (many diffs) |
| 7 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | NM_001172157.1 | 59.8% | 54.3% | (many diffs) |
| 8 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_030252483.1 | 59.8% | 54.3% | (many diffs) |
| 9 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_006529298.3 | 56.2% | 50.6% | (many diffs) |
| 10 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_017319469.2 | 52.4% | 46.7% | (many diffs) |
| 11 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_006529300.4 | 41.3% | 37.7% | (many diffs) |
| 12 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_006529301.4 | 41.3% | 37.7% | (many diffs) |
| 13 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_030252485.1 | 41.3% | 37.7% | (many diffs) |
| 14 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_030252488.1 | 41.3% | 37.7% | (many diffs) |
| 15 | mouse | 208718 | Dis3l2 | DIS3 like 3'-5' exoribonucl... | XM_030252497.1 | 37.6% | 33.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1902
- ORF length:
- 1836
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa cctccggtcc ctggggaccc acagaggtgt gtctgctgtg gctggtccac 121 atgacattgg tgcttcgcca ggtgacaaaa agtcaaagaa caggtccaca cgagggaaga 181 aaaagagcat atttgaaact tacatgtcca aggaggatgt ttcagaaggc ttgaagagag 241 gaacactcat ccagggtgta ttgagaatta atccaaagaa gtttcatgaa gccttcattc 301 cttccccgga tggtgatcga gacattttta ttgatggggt tgttgctcgt aatagagcct 361 taaatgggga tctggtggtc gtgaaactgc ttcccgagga gcattggaag gtagttaaac 421 cagagagcaa tgacaaagaa acagaagctg cgtatgaatc agatatcccc gaggagctct 481 gtggacacca tctcccgcaa cagtccctga aaagctataa tgacagtcct gatgtcattg 541 tagaggctca gtttgatggc agcgactcag aagatggaca tggcatcaca caaaatgtgc 601 tggttgatgg tgttaagaaa ctctcagttt gtgtttctga gaaaggaaga gaggatggtg 661 atgcaccggt tacaaaagat gagaccacct gcatttcaca agacacaaga gctttatcgg 721 agaaatccct gcaaagatca gcaaaggtgg tttacatctt ggagaaaaaa cattctcgag 781 cagcaaccgg cttcctcaaa ctcttggctg ataagaacag cgaactgttt aggaaatacg 841 ccctgttttc tccctcagac caccgagtgc ctagaattta tgtgcctctc aaggactgtc 901 cccaggactt tgtggcacgg cctaaagatt atgccaacac actgttcatc tgccgcattg 961 tggactggaa ggaggactgc aattttgccc tggggcagct ggctaagagt cttgggcagg 1021 ctggtgaaat tgagcctgaa acagaaggaa tactaacaga gtatggcgtg gatttctctg 1081 atttctcttc agaagttcta gaatgtcttc ctcaaggcct gccatggaca attccaccag 1141 aggagttcag caagagaagg gatttaagaa aagactgtat cttcaccatt gacccatcaa 1201 ccgcccgaga cctcgatgat gccctctcct gcaagccact cgctgacggc aacttcaaag 1261 tgggagttca cattgctgac gtgagttact ttgttccgga gggatctgat ctggataaag 1321 tggctgccga gagggctaca agcgtctact tggttcaaaa ggtggtcccc atgcttccca 1381 ggctgctgtg tgaggagctg tgcagcctca accccatgtc cgacaagctg accttctctg 1441 tgatctggac actgactcca gagggcaaga tccttgatga atggtttggc cggaccatca 1501 tccgctccTG CACCAAACTT AGCTACGAGC ATGCACAGAG CATGATTGAA AGCCCAACTG 1561 AGAAAATCCC TGCGAAAGAG CTGCCCCCCA TTTCCCCAGA GCATAGCAGC GAGGAGGTAC 1621 ACCAGGCCGT CTTGAATCTC CACGGAATTG CCAAGCAGTT ACGCCAGCAG CGCTTTGTGG 1681 ACGGCGCACT TCGTTTGGAT CAGCTAAAGC TTGCTTTCAC TCTGGACCAC GAGACCGGAT 1741 TGCCTCAAGG ATGTCATATC TATGAGTACC GCGAGAGCAA CAAGCCCTGC TGCGCCGGCA 1801 CCCCCCGCCC CAAACAAGGA TGCTCAGTGA CCTGGTGGAA TTCTGCGACC AGATGGGGCT 1861 GCCCGTGGAC TTCAGCTCCG CAGGAGCCCT CAATAAAAGC CTGCCCAACT TTCTTGTACA 1921 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1981 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2041 AGGACGAGAT GTAGTATCCA ACTTCATTTT GACGCGTTAA GTCgacaatc aacctctgga 2101 ttacaaaatt tgtgaaagat t