Transcript: Human NR_047679.1

Homo sapiens UGDH antisense RNA 1 (UGDH-AS1), long non-coding RNA.

Source:
NCBI, updated 2018-06-17
Taxon:
Homo sapiens (human)
Gene:
UGDH-AS1 (100885776)
Length:
2967
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_047679.1
NBCI Gene record:
UGDH-AS1 (100885776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_047679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150972 CCACTCCTATTCAACATAGTA pLKO.1 1776 3UTR 100% 5.625 2.813 Y LOC401623 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_047679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13802 pDONR223 100% 23.8% None (many diffs) n/a
2 ccsbBroad304_13802 pLX_304 0% 23.8% V5 (many diffs) n/a
3 TRCN0000470799 AAGCCATAAGTTAGAAACAAACCG pLX_317 52.2% 23.8% V5 (many diffs) n/a
Download CSV