Transcript: Human NR_048545.1

Homo sapiens microsomal glutathione S-transferase 1 (MGST1), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
MGST1 (4257)
Length:
849
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_048545.1
NBCI Gene record:
MGST1 (4257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_048545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164526 CTTGGAATTGGCCTCCTGTAT pLKO.1 254 3UTR 100% 4.950 3.960 N MGST1 n/a
2 TRCN0000158997 GCATTGCCAATATCCTGTATT pLKO.1 601 3UTR 100% 13.200 9.240 N MGST1 n/a
3 TRCN0000280773 GCATTGCCAATATCCTGTATT pLKO_005 601 3UTR 100% 13.200 9.240 N MGST1 n/a
4 TRCN0000159257 GTACTGCAACTGCATTCTATA pLKO.1 182 3UTR 100% 13.200 9.240 N MGST1 n/a
5 TRCN0000297898 GTACTGCAACTGCATTCTATA pLKO_005 182 3UTR 100% 13.200 9.240 N MGST1 n/a
6 TRCN0000159892 GCCAATATCCTGTATTCTTGT pLKO.1 606 3UTR 100% 4.950 3.465 N MGST1 n/a
7 TRCN0000162389 CATACAACTCAGCATCCAGTT pLKO.1 471 3UTR 100% 4.050 2.835 N MGST1 n/a
8 TRCN0000280910 CATACAACTCAGCATCCAGTT pLKO_005 471 3UTR 100% 4.050 2.835 N MGST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_048545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01009 pDONR223 100% 39.1% None 1_90del;214_215ins95;461_849del n/a
2 ccsbBroad304_01009 pLX_304 0% 39.1% V5 1_90del;214_215ins95;461_849del n/a
3 TRCN0000466615 AATTGTCATTACAGGACCGTTAGT pLX_317 87.6% 39.1% V5 1_90del;214_215ins95;461_849del n/a
4 TRCN0000476092 TTGCGCCCGCGTTTGCCTGTCGCC pLX_317 87% 39.1% V5 1_90del;214_215ins95;461_849del n/a
5 ccsbBroadEn_06582 pDONR223 100% 39% None (many diffs) n/a
6 ccsbBroad304_06582 pLX_304 0% 39% V5 (many diffs) n/a
Download CSV