Transcript: Human NR_052017.2

Homo sapiens mediator complex subunit 24 (MED24), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MED24 (9862)
Length:
3406
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_052017.2
NBCI Gene record:
MED24 (9862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_052017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230510 GCGAAGACATTGAGGATTATA pLKO_005 2521 3UTR 100% 15.000 21.000 N MED24 n/a
2 TRCN0000230511 ATGCGACTGCTGAGCTCTAAT pLKO_005 2583 3UTR 100% 13.200 18.480 N MED24 n/a
3 TRCN0000019649 CCGCGAAGACATTGAGGATTA pLKO.1 2519 3UTR 100% 10.800 15.120 N MED24 n/a
4 TRCN0000230512 CAGGATGTCTCCCGGTTTCTT pLKO_005 3142 3UTR 100% 5.625 7.875 N MED24 n/a
5 TRCN0000217980 TTCTGCAACAACCTGATTAAG pLKO_005 2241 3UTR 100% 13.200 9.240 N MED24 n/a
6 TRCN0000230509 GCCAGCGTCAACAACCTTATG pLKO_005 1137 3UTR 100% 10.800 7.560 N MED24 n/a
7 TRCN0000019651 CCAATGGGCAATCAACATGAA pLKO.1 148 3UTR 100% 4.950 3.465 N MED24 n/a
8 TRCN0000019650 CGTCAACAACCTTATGGCTAA pLKO.1 1142 3UTR 100% 4.050 2.835 N MED24 n/a
9 TRCN0000019653 CTAGTGCAGATGAAGTGGCAT pLKO.1 1716 3UTR 100% 0.000 0.000 N MED24 n/a
10 TRCN0000019652 CACTGTCACAAACATCCTCAA pLKO.1 1256 3UTR 100% 4.050 2.430 N MED24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_052017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07499 pDONR223 100% 83% None (many diffs) n/a
2 ccsbBroad304_07499 pLX_304 0% 83% V5 (many diffs) n/a
3 TRCN0000466728 GATGGCTTTCTTTAACAGGCGAGC pLX_317 10.8% 83% V5 (many diffs) n/a
Download CSV