Transcript: Human NR_073005.1

Homo sapiens dihydrouridine synthase 4 like (DUS4L), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
DUS4L (11062)
Length:
2012
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073005.1
NBCI Gene record:
DUS4L (11062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064855 GCACATCAGCAATCATAGATT pLKO.1 1003 3UTR 100% 5.625 3.938 N DUS4L n/a
2 TRCN0000333715 GCACATCAGCAATCATAGATT pLKO_005 1003 3UTR 100% 5.625 3.938 N DUS4L n/a
3 TRCN0000064856 CCCAATGGTTCGATATTCAAA pLKO.1 309 3UTR 100% 5.625 2.813 Y DUS4L n/a
4 TRCN0000315801 CCCAATGGTTCGATATTCAAA pLKO_005 309 3UTR 100% 5.625 2.813 Y DUS4L n/a
5 TRCN0000064854 CCAATGATTGTTGCCGCTGAT pLKO.1 382 3UTR 100% 4.050 2.025 Y DUS4L n/a
6 TRCN0000315881 CCAATGATTGTTGCCGCTGAT pLKO_005 382 3UTR 100% 4.050 2.025 Y DUS4L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11588 pDONR223 100% 29.2% None 1_458del;1047_2012del n/a
2 ccsbBroad304_11588 pLX_304 0% 29.2% V5 1_458del;1047_2012del n/a
3 TRCN0000467647 AGGGTCATCAGTACTTGAGAACAC pLX_317 76.7% 29.2% V5 1_458del;1047_2012del n/a
Download CSV