Transcript: Human NR_073037.2

Homo sapiens stomatin (STOM), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
STOM (2040)
Length:
3275
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073037.2
NBCI Gene record:
STOM (2040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029161 CACCGTTATAACTTTCCCAAT pLKO.1 316 3UTR 100% 4.050 5.670 N STOM n/a
2 TRCN0000319395 CACCGTTATAACTTTCCCAAT pLKO_005 316 3UTR 100% 4.050 5.670 N STOM n/a
3 TRCN0000029163 GCGTGGATGGTGTGGTCTATT pLKO.1 543 3UTR 100% 13.200 10.560 N STOM n/a
4 TRCN0000319309 GCGTGGATGGTGTGGTCTATT pLKO_005 543 3UTR 100% 13.200 10.560 N STOM n/a
5 TRCN0000029159 GTGGAAATTAAGGATGTGAAA pLKO.1 767 3UTR 100% 4.950 3.465 N STOM n/a
6 TRCN0000029160 CCATAGATATGCTGCAAGGAA pLKO.1 1008 3UTR 100% 3.000 2.100 N STOM n/a
7 TRCN0000319382 CCATAGATATGCTGCAAGGAA pLKO_005 1008 3UTR 100% 3.000 2.100 N STOM n/a
8 TRCN0000029162 CATCTTTAGATTGGGTCGCAT pLKO.1 385 3UTR 100% 2.640 1.848 N STOM n/a
9 TRCN0000319308 CATCTTTAGATTGGGTCGCAT pLKO_005 385 3UTR 100% 2.640 1.848 N STOM n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1765 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1765 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06166 pDONR223 100% 26.3% None (many diffs) n/a
2 ccsbBroad304_06166 pLX_304 0% 26.3% V5 (many diffs) n/a
3 TRCN0000479857 ACCATACGAGCTATAAAGGCACCT pLX_317 43.8% 26.3% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 5.8% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 5.8% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 5.8% V5 (many diffs) n/a
Download CSV