Transcript: Human NR_073050.2

Homo sapiens death effector domain containing 2 (DEDD2), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DEDD2 (162989)
Length:
1524
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073050.2
NBCI Gene record:
DEDD2 (162989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164876 GTCTCCAGAACGCTATAGCTA pLKO.1 48 3UTR 100% 3.000 2.400 N DEDD2 n/a
2 TRCN0000159755 GCACATTGTATCTCTGATCTT pLKO.1 992 3UTR 100% 4.950 3.465 N DEDD2 n/a
3 TRCN0000164940 GCAGTCAAGCAGTTCTGCAAA pLKO.1 120 3UTR 100% 4.950 3.465 N DEDD2 n/a
4 TRCN0000165519 GCACACACTTCTTTGGCCTAA pLKO.1 1108 3UTR 100% 4.050 2.835 N DEDD2 n/a
5 TRCN0000161569 GCTGAACATAGACTTGCACTT pLKO.1 1315 3UTR 100% 4.050 2.835 N DEDD2 n/a
6 TRCN0000166158 CAAGTTCTCAGAGCTCTCCTA pLKO.1 456 3UTR 100% 2.640 1.848 N DEDD2 n/a
7 TRCN0000166134 CAGAACGCTATAGCTATGGCA pLKO.1 53 3UTR 100% 0.750 0.525 N DEDD2 n/a
8 TRCN0000166424 CAGCTCTTCAAAGAGGACAGA pLKO.1 78 3UTR 100% 2.640 1.584 N DEDD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05122 pDONR223 100% 36.5% None (many diffs) n/a
2 ccsbBroad304_05122 pLX_304 0% 36.5% V5 (many diffs) n/a
3 TRCN0000478644 CACTAGAAGGCTCACCATTACCCT pLX_317 21.7% 36.5% V5 (many diffs) n/a
4 TRCN0000469081 TTCTGATTTTAACTGGTTACGTTA pLX_317 70.7% 14.3% V5 (not translated due to frame shift) (many diffs) n/a
5 ccsbBroadEn_16115 pDONR223 0% 14.3% None (many diffs) n/a
6 ccsbBroad304_16115 pLX_304 0% 14.3% V5 (many diffs) n/a
Download CSV