Transcript: Human NR_073121.3

Homo sapiens ubiquitin conjugating enzyme E2 W (UBE2W), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
UBE2W (55284)
Length:
8276
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073121.3
NBCI Gene record:
UBE2W (55284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073121.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000280233 AGAGACGACCACCGGATAATT pLKO_005 302 3UTR 100% 15.000 21.000 N UBE2W n/a
2 TRCN0000007713 CGCTCTCAGTCCAATCAGTTT pLKO.1 242 3UTR 100% 4.950 3.960 N UBE2W n/a
3 TRCN0000280045 CGCTCTCAGTCCAATCAGTTT pLKO_005 242 3UTR 100% 4.950 3.960 N UBE2W n/a
4 TRCN0000007714 CCTCCTGGAATGACCTTAAAT pLKO.1 98 3UTR 100% 15.000 10.500 N UBE2W n/a
5 TRCN0000280044 CCTCCTGGAATGACCTTAAAT pLKO_005 98 3UTR 100% 15.000 10.500 N UBE2W n/a
6 TRCN0000241025 TGCGAACATGTAACAAGAATC pLKO_005 332 3UTR 100% 10.800 7.560 N Ube2w n/a
7 TRCN0000007716 CATCCTCATGTTTATAGCAAT pLKO.1 178 3UTR 100% 4.950 3.465 N UBE2W n/a
8 TRCN0000279793 CATCCTCATGTTTATAGCAAT pLKO_005 178 3UTR 100% 4.950 3.465 N UBE2W n/a
9 TRCN0000007712 GCATGAATTAACATGCGTCTT pLKO.1 938 3UTR 100% 0.405 0.284 N UBE2W n/a
10 TRCN0000297766 GCATGAATTAACATGCGTCTT pLKO_005 938 3UTR 100% 0.405 0.284 N UBE2W n/a
11 TRCN0000156198 CCTCTTGAGTAGCTGGGATTA pLKO.1 4759 3UTR 100% 10.800 5.400 Y MRPL49 n/a
12 TRCN0000276507 CCTCTTGAGTAGCTGGGATTA pLKO_005 4759 3UTR 100% 10.800 5.400 Y MRPL49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073121.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12198 pDONR223 100% 4.3% None (many diffs) n/a
2 ccsbBroad304_12198 pLX_304 0% 4.3% V5 (many diffs) n/a
3 TRCN0000472955 AACAAGGGTAGCCGCACGAGGCGT pLX_317 90.5% 4.3% V5 (many diffs) n/a
4 ccsbBroadEn_03571 pDONR223 100% 4.1% None 1_40del;147_148ins103;391_8276del n/a
5 ccsbBroad304_03571 pLX_304 0% 4.1% V5 1_40del;147_148ins103;391_8276del n/a
6 TRCN0000474929 CCATCCTTACCAGAAACAACTCCC pLX_317 100% 4.1% V5 1_40del;147_148ins103;391_8276del n/a
Download CSV