Transcript: Mouse NR_073122.1

Mus musculus ubiquitin-conjugating enzyme E2W (putative) (Ube2w), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ube2w (66799)
Length:
3036
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073122.1
NBCI Gene record:
Ube2w (66799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241025 TGCGAACATGTAACAAGAATC pLKO_005 379 3UTR 100% 10.800 15.120 N Ube2w n/a
2 TRCN0000241023 GCCGGCAATGGACGTTGTAAA pLKO_005 788 3UTR 100% 13.200 10.560 N Ube2w n/a
3 TRCN0000241026 AGAGACGACCACCAGATAATT pLKO_005 349 3UTR 100% 15.000 10.500 N Ube2w n/a
4 TRCN0000241024 TGTGTATAGCAATGGTCATAT pLKO_005 233 3UTR 100% 13.200 7.920 N Ube2w n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12198 pDONR223 100% 10.8% None (many diffs) n/a
2 ccsbBroad304_12198 pLX_304 0% 10.8% V5 (many diffs) n/a
3 TRCN0000472955 AACAAGGGTAGCCGCACGAGGCGT pLX_317 90.5% 10.8% V5 (many diffs) n/a
4 ccsbBroadEn_03571 pDONR223 100% 10.5% None (many diffs) n/a
5 ccsbBroad304_03571 pLX_304 0% 10.5% V5 (many diffs) n/a
6 TRCN0000474929 CCATCCTTACCAGAAACAACTCCC pLX_317 100% 10.5% V5 (many diffs) n/a
Download CSV