Transcript: Human NR_073383.1

Homo sapiens heat shock protein 90 beta family member 2, pseudogene (HSP90B2P), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
HSP90B2P (7190)
Length:
2752
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073383.1
NBCI Gene record:
HSP90B2P (7190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276250 ATCCTGTGTGGAGAGGGAATG pLKO_005 2517 3UTR 100% 6.000 3.000 Y HSP90B1 n/a
2 TRCN0000029428 CGACGAATTAAGGAAGATGAA pLKO.1 2185 3UTR 100% 4.950 2.475 Y HSP90B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489328 AGTGAATAATCTACATCTGTAAAA pLX_317 14.6% 81% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_13971 pDONR223 100% 32.1% None (many diffs) n/a
3 ccsbBroad304_13971 pLX_304 0% 32.1% V5 (many diffs) n/a
Download CSV