Transcript: Human NR_073424.2

Homo sapiens COPI coat complex subunit zeta 1 (COPZ1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
COPZ1 (22818)
Length:
1798
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073424.2
NBCI Gene record:
COPZ1 (22818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380555 GTAGCTACACTTCAGATTAAA pLKO_005 796 3UTR 100% 15.000 12.000 N COPZ1 n/a
2 TRCN0000379566 GTAAAGCTCCCAGCATATTTA pLKO_005 677 3UTR 100% 15.000 10.500 N COPZ1 n/a
3 TRCN0000100681 GCCATCCTGATTCTGGACAAT pLKO.1 76 3UTR 100% 4.950 3.465 N Copz1 n/a
4 TRCN0000363778 GCCATCCTGATTCTGGACAAT pLKO_005 76 3UTR 100% 4.950 3.465 N Copz1 n/a
5 TRCN0000065001 GTCAGCCAAAGAACAGATCAA pLKO.1 436 3UTR 100% 4.950 3.465 N COPZ1 n/a
6 TRCN0000298993 GTCAGCCAAAGAACAGATCAA pLKO_005 436 3UTR 100% 4.950 3.465 N COPZ1 n/a
7 TRCN0000374707 AGCCAAAGAACAGATCAAGTG pLKO_005 439 3UTR 100% 4.050 2.835 N Copz1 n/a
8 TRCN0000064999 CTTCGACTCATTGAGCCAGAT pLKO.1 232 3UTR 100% 4.050 2.835 N COPZ1 n/a
9 TRCN0000299062 CTTCGACTCATTGAGCCAGAT pLKO_005 232 3UTR 100% 4.050 2.835 N COPZ1 n/a
10 TRCN0000065000 CCTGTATACTGTCAAAGCCAT pLKO.1 60 3UTR 100% 2.640 1.848 N COPZ1 n/a
11 TRCN0000298991 CCTGTATACTGTCAAAGCCAT pLKO_005 60 3UTR 100% 2.640 1.848 N COPZ1 n/a
12 TRCN0000381033 TGCTCCCTTGCCCTGACATTT pLKO_005 752 3UTR 100% 13.200 7.920 N COPZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02686 pDONR223 100% 23.2% None 1_33del;202_203ins92;473_1798del n/a
2 ccsbBroad304_02686 pLX_304 0% 23.2% V5 1_33del;202_203ins92;473_1798del n/a
3 TRCN0000466412 AAACCCCAGAACTGAAAACCACAG pLX_317 74.5% 23.2% V5 1_33del;202_203ins92;473_1798del n/a
Download CSV