Transcript: Human NR_073432.1

Homo sapiens CSAG family member 4 (pseudogene) (CSAG4), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
CSAG4 (100130935)
Length:
776
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073432.1
NBCI Gene record:
CSAG4 (100130935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163988 CAAGGAAGTTCCAGGAACAAA pLKO.1 418 3UTR 100% 5.625 2.813 Y CSAG1 n/a
2 TRCN0000164670 CTGGTGAAGATGTCCAGGAAA pLKO.1 311 3UTR 100% 4.950 2.475 Y CSAG1 n/a
3 TRCN0000165488 GTCAAGGAAGTTCCAGGAACA pLKO.1 416 3UTR 100% 4.050 2.025 Y CSAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05732 pDONR223 100% 36.8% None (many diffs) n/a
2 ccsbBroad304_05732 pLX_304 0% 36.8% V5 (many diffs) n/a
3 TRCN0000469134 GATCCATCCTAGTGGCTCACGGAC pLX_317 100% 36.8% V5 (many diffs) n/a
4 ccsbBroadEn_09724 pDONR223 100% 28.4% None (many diffs) n/a
5 ccsbBroad304_09724 pLX_304 0% 28.4% V5 (many diffs) n/a
Download CSV