Transcript: Human NR_073527.1

Homo sapiens protein phosphatase 2 regulatory subunit Bbeta (PPP2R2B), transcript variant 12, non-coding RNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PPP2R2B (5521)
Length:
2130
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073527.1
NBCI Gene record:
PPP2R2B (5521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040169 GCGGCTACAAATAACCTATAT pLKO.1 1639 3UTR 100% 13.200 18.480 N PPP2R2B n/a
2 TRCN0000018341 GACATTATCTCTACGGTAGAA pLKO.1 424 3UTR 100% 4.950 6.930 N PPP2R2B n/a
3 TRCN0000294422 GACATTATCTCTACGGTAGAA pLKO_005 424 3UTR 100% 4.950 6.930 N PPP2R2B n/a
4 TRCN0000040170 GCTGACATTATCTCTACGGTA pLKO.1 421 3UTR 100% 2.640 3.696 N PPP2R2B n/a
5 TRCN0000009861 GAAATTATCTCTTCGATTTCG pLKO.1 1186 3UTR 100% 0.495 0.693 N PPP2R2B n/a
6 TRCN0000307348 GAAATTATCTCTTCGATTTCG pLKO_005 1186 3UTR 100% 0.495 0.693 N PPP2R2B n/a
7 TRCN0000009862 TAATCTCACATACTGAATACT pLKO.1 1704 3UTR 100% 5.625 3.938 N PPP2R2B n/a
8 TRCN0000294476 TAATCTCACATACTGAATACT pLKO_005 1704 3UTR 100% 5.625 3.938 N PPP2R2B n/a
9 TRCN0000040171 CGCACACACATATCACATCAA pLKO.1 861 3UTR 100% 4.950 3.465 N PPP2R2B n/a
10 TRCN0000040172 CTTACTTTCTTCTGTCTACTA pLKO.1 662 3UTR 100% 4.950 2.970 N PPP2R2B n/a
11 TRCN0000040168 GCTAACAGTAATTCTTCCATA pLKO.1 1909 3UTR 100% 4.950 2.970 N PPP2R2B n/a
12 TRCN0000071491 CCCGAGTTCGATTACCTGAAA pLKO.1 583 3UTR 100% 4.950 6.930 N Ppp2r2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01264 pDONR223 100% 62.3% None 1_351del;1681_2130del n/a
2 ccsbBroad304_01264 pLX_304 0% 62.3% V5 1_351del;1681_2130del n/a
3 TRCN0000469328 ACGCTCCCCGTTCAGGGCGGTTCC pLX_317 35.1% 62.3% V5 1_351del;1681_2130del n/a
Download CSV