Transcript: Mouse NR_075087.1

Mus musculus nucleoporin 88 (Nup88), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Nup88 (19069)
Length:
2792
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_075087.1
NBCI Gene record:
Nup88 (19069)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_075087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323128 AGATTCAGCGGAGGGTCAAAT pLKO_005 2241 3UTR 100% 13.200 18.480 N NUP88 n/a
2 TRCN0000349919 GATTCAGCGGAGGGTCAAATT pLKO_005 2242 3UTR 100% 13.200 18.480 N Nup88 n/a
3 TRCN0000313627 GTAGCACTTATCGGAAGTAAA pLKO_005 957 3UTR 100% 13.200 18.480 N Nup88 n/a
4 TRCN0000055318 CCCAACATCATGTAGCACTTA pLKO.1 946 3UTR 100% 4.950 6.930 N Nup88 n/a
5 TRCN0000055320 CCCACTAAGGTGATTGTACTT pLKO.1 1212 3UTR 100% 4.950 6.930 N Nup88 n/a
6 TRCN0000313630 ACATAACTTGAAGGCTGTAAA pLKO_005 2607 3UTR 100% 13.200 9.240 N Nup88 n/a
7 TRCN0000055321 GACTCCTTTGAGAAGCATATT pLKO.1 2063 3UTR 100% 13.200 9.240 N Nup88 n/a
8 TRCN0000317203 GACTCCTTTGAGAAGCATATT pLKO_005 2063 3UTR 100% 13.200 9.240 N Nup88 n/a
9 TRCN0000055319 CCAATTAAACTGCACAGAGAT pLKO.1 1761 3UTR 100% 4.950 3.465 N Nup88 n/a
10 TRCN0000055322 CCCTTGTTTGAAATCCATCAA pLKO.1 909 3UTR 100% 4.950 3.465 N Nup88 n/a
11 TRCN0000317202 CCCTTGTTTGAAATCCATCAA pLKO_005 909 3UTR 100% 4.950 3.465 N Nup88 n/a
12 TRCN0000139972 GCTGCATGGTATCCAAGTGAA pLKO.1 1116 3UTR 100% 4.950 3.465 N NUP88 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_075087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01114 pDONR223 100% 57.6% None (many diffs) n/a
2 ccsbBroad304_01114 pLX_304 0% 57.6% V5 (many diffs) n/a
3 TRCN0000481645 AGGAGCGGCATAAAGAGTTATTCC pLX_317 21.6% 57.6% V5 (many diffs) n/a
Download CSV