Transcript: Human NR_103483.1

Homo sapiens RWD domain containing 3 (RWDD3), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-04-14
Taxon:
Homo sapiens (human)
Gene:
RWDD3 (25950)
Length:
1267
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103483.1
NBCI Gene record:
RWDD3 (25950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004094 GATGGTAAATGAACACTTGTT pLKO.1 1155 3UTR 100% 4.950 3.465 N RWDD3 n/a
2 TRCN0000433555 AGAAGTGGGCTTCAGATTTAA pLKO_005 555 3UTR 100% 15.000 7.500 Y RWDD3 n/a
3 TRCN0000004095 ACATGAGAGCAAAGACTAAAT pLKO.1 519 3UTR 100% 13.200 6.600 Y RWDD3 n/a
4 TRCN0000432027 GATTTATGGATGCGGATATAC pLKO_005 204 3UTR 100% 13.200 6.600 Y RWDD3 n/a
5 TRCN0000004096 TGGATGATGGATTGTGGATAA pLKO.1 480 3UTR 100% 10.800 5.400 Y RWDD3 n/a
6 TRCN0000004093 CCAGTCAATTATCCTTCATGT pLKO.1 248 3UTR 100% 4.950 2.475 Y RWDD3 n/a
7 TRCN0000418354 TTGTCGGAGCCTATGGTTCAT pLKO_005 359 3UTR 100% 4.950 2.475 Y RWDD3 n/a
8 TRCN0000004092 CATATCCTCAGCCAACCAGAA pLKO.1 413 3UTR 100% 4.050 2.025 Y RWDD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07970 pDONR223 100% 46% None (many diffs) n/a
2 ccsbBroad304_07970 pLX_304 0% 46% V5 (many diffs) n/a
3 TRCN0000469422 TGTCGGGTTGATTCAGGCCTCGAT pLX_317 65.9% 46% V5 (many diffs) n/a
4 ccsbBroadEn_15777 pDONR223 0% 42.8% None (many diffs) n/a
5 ccsbBroad304_15777 pLX_304 0% 42.8% V5 (many diffs) n/a
6 TRCN0000465451 ACCGAGGTCTATATCCGGGTCAAT pLX_317 46.3% 42.8% V5 (many diffs) n/a
Download CSV