Transcript: Human NR_103488.1

Homo sapiens transcriptional adaptor 3 (TADA3), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-10-09
Taxon:
Homo sapiens (human)
Gene:
TADA3 (10474)
Length:
1966
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103488.1
NBCI Gene record:
TADA3 (10474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276386 TTCAGTGTGCCGCATACTAAG pLKO_005 1175 3UTR 100% 10.800 15.120 N TADA3 n/a
2 TRCN0000015735 CCTATGGAGGATTCTCCTATT pLKO.1 1085 3UTR 100% 10.800 7.560 N TADA3 n/a
3 TRCN0000276385 CAAATGGCGGCAGTCTCTAGA pLKO_005 1659 3UTR 100% 4.950 3.465 N TADA3 n/a
4 TRCN0000015734 GCTGTGGCTGACAAGAAGAAA pLKO.1 908 3UTR 100% 5.625 3.375 N TADA3 n/a
5 TRCN0000285552 GCTGTGGCTGACAAGAAGAAA pLKO_005 908 3UTR 100% 5.625 3.375 N TADA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02446 pDONR223 100% 51.4% None (many diffs) n/a
2 ccsbBroad304_02446 pLX_304 0% 51.4% V5 (many diffs) n/a
3 TRCN0000473532 CTGCATTGCTAAACTATGCTTGTC pLX_317 38.2% 51.3% V5 (many diffs) n/a
4 ccsbBroadEn_15713 pDONR223 0% 42.4% None (many diffs) n/a
5 TRCN0000472055 ACAGGACGCTACATGTCGTCCACG pLX_317 42.9% 42.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV