Transcript: Human NR_103502.1

Homo sapiens leukocyte immunoglobulin like receptor A1 (LILRA1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LILRA1 (11024)
Length:
2189
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103502.1
NBCI Gene record:
LILRA1 (11024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428412 GTGTGTTTCTGATGTCAGCTA pLKO_005 1151 3UTR 100% 2.640 1.848 N LILRA1 n/a
2 TRCN0000056875 CTCAGATCAATACACGAATAT pLKO.1 1521 3UTR 100% 13.200 7.920 N LILRA1 n/a
3 TRCN0000056873 CCCACAGGAGATTGTGAAGAA pLKO.1 635 3UTR 100% 4.950 2.970 N LILRA1 n/a
4 TRCN0000056874 GAGAAGATGAACACCCACAAT pLKO.1 895 3UTR 100% 4.950 2.475 Y LILRA1 n/a
5 TRCN0000056877 GTTCTGTATAAGGAGGGAGAA pLKO.1 1182 3UTR 100% 4.050 2.025 Y LILRA1 n/a
6 TRCN0000364774 TGAGGAGATGCTTGCCGTGAT pLKO_005 1734 3UTR 100% 4.050 2.025 Y LILRA3 n/a
7 TRCN0000056876 CCACACTTTCCTTCTGACCAA pLKO.1 1472 3UTR 100% 2.640 1.320 Y LILRA1 n/a
8 TRCN0000056847 CGACAGATTTGTTCTGTATAA pLKO.1 1172 3UTR 100% 1.320 0.660 Y LILRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02599 pDONR223 100% 62.7% None (many diffs) n/a
2 ccsbBroad304_02599 pLX_304 0% 62.7% V5 (many diffs) n/a
3 TRCN0000476912 AATATTGCGCGCAACCGAGCATCT pLX_317 19.2% 62.7% V5 (many diffs) n/a
4 ccsbBroadEn_07730 pDONR223 100% 56.3% None (many diffs) n/a
5 ccsbBroad304_07730 pLX_304 0% 56.3% V5 (many diffs) n/a
6 ccsbBroadEn_07729 pDONR223 100% 54.8% None (many diffs) n/a
7 ccsbBroad304_07729 pLX_304 0% 54.8% V5 (many diffs) n/a
8 TRCN0000478306 AGCCAAGCTCAGGCTTTGGACACT pLX_317 25.7% 54.8% V5 (many diffs) n/a
Download CSV