Construct: ORF TRCN0000478306
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001310.1_s317c1
- Derived from:
- ccsbBroadEn_07729
- DNA Barcode:
- AGCCAAGCTCAGGCTTTGGACACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LILRA3 (11026)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478306
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11026 | LILRA3 | leukocyte immunoglobulin li... | NM_006865.4 | 99.8% | 99.5% | 7C>T;314C>T |
| 2 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_001278319.1 | 91.5% | 84.9% | (many diffs) |
| 3 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001278399.2 | 88.1% | 80.9% | (many diffs) |
| 4 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526388.1 | 87.5% | 79% | (many diffs) |
| 5 | human | 11026 | LILRA3 | leukocyte immunoglobulin li... | NM_001172654.2 | 85.2% | 84.9% | 7C>T;314C>T;469_470ins192 |
| 6 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278406.2 | 84.6% | 76.5% | (many diffs) |
| 7 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_006866.4 | 82.5% | 73.3% | (many diffs) |
| 8 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_006863.4 | 82.1% | 76% | (many diffs) |
| 9 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026192.1 | 81.6% | 75% | (many diffs) |
| 10 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001130917.3 | 81.6% | 73.4% | (many diffs) |
| 11 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526385.1 | 81.6% | 73.4% | (many diffs) |
| 12 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001290270.1 | 80.2% | 71.2% | (many diffs) |
| 13 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526387.1 | 80.2% | 71.2% | (many diffs) |
| 14 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001290271.2 | 79.7% | 70.2% | (many diffs) |
| 15 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_006722986.1 | 79.7% | 70.2% | (many diffs) |
| 16 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526386.1 | 77.5% | 68.2% | (many diffs) |
| 17 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526390.1 | 75.7% | 64.3% | (many diffs) |
| 18 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278405.2 | 75.4% | 67.9% | (many diffs) |
| 19 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_935716.2 | 71.4% | (many diffs) | |
| 20 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526336.2 | 67% | 61.2% | (many diffs) |
| 21 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026191.1 | 66.8% | 61.1% | (many diffs) |
| 22 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526335.2 | 65.6% | 59.6% | (many diffs) |
| 23 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001080978.4 | 64.6% | 58% | (many diffs) |
| 24 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278403.2 | 64.6% | 58% | (many diffs) |
| 25 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_005874.5 | 64.4% | 57.9% | (many diffs) |
| 26 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001278398.2 | 62.8% | 57.7% | (many diffs) |
| 27 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_006669.6 | 61.6% | 56.3% | (many diffs) |
| 28 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026185.1 | 61.6% | 56.3% | (many diffs) |
| 29 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NR_103503.1 | 61.6% | (many diffs) | |
| 30 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081639.3 | 61.5% | 56.2% | (many diffs) |
| 31 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081638.3 | 61.5% | 56.2% | (many diffs) |
| 32 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081637.2 | 61.4% | 56.1% | (many diffs) |
| 33 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_017026224.1 | 61.2% | 53.1% | (many diffs) |
| 34 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026183.2 | 60.7% | 55.4% | (many diffs) |
| 35 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026184.2 | 60.6% | 55% | (many diffs) |
| 36 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026182.2 | 60.6% | 55.3% | (many diffs) |
| 37 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526332.3 | 60.5% | 54.9% | (many diffs) |
| 38 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526331.2 | 60.4% | 54.8% | (many diffs) |
| 39 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026190.1 | 60.1% | 54.8% | (many diffs) |
| 40 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026189.1 | 60% | 54.7% | (many diffs) |
| 41 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026188.1 | 59.9% | 54.7% | (many diffs) |
| 42 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026186.1 | 59.9% | 54.7% | (many diffs) |
| 43 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026187.1 | 59.9% | 54.7% | (many diffs) |
| 44 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526389.1 | 59.6% | 51.5% | (many diffs) |
| 45 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_001278318.2 | 55.6% | 42.6% | (many diffs) |
| 46 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526391.1 | 54.8% | 41.1% | (many diffs) |
| 47 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NR_103502.1 | 54.8% | (many diffs) | |
| 48 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278404.2 | 48.1% | 43.2% | (many diffs) |
| 49 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NR_103518.2 | 44% | (many diffs) | |
| 50 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NR_103521.3 | 40.8% | (many diffs) | |
| 51 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_002958244.1 | 36.4% | (many diffs) | |
| 52 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_001753590.2 | 36.4% | (many diffs) | |
| 53 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_001753591.1 | 35.7% | (many diffs) | |
| 54 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NR_103501.2 | 34.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1383
- ORF length:
- 1317
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ctccatcctc acggtcctga tctgtctcgg gctgagcctg gaccccagga 121 cccacgtgca ggcagggccc ctccccaagc ccaccctctg ggctgagcca ggctctgtga 181 tcacccaagg gagtcctgtg accctcaggt gtcaggggag cctggagacg caggagtacc 241 atctatatag agaaaagaaa acagcactct ggattacacg gatcccacag gagcttgtga 301 agaagggcca gttccccatc ctatccatca cctgggaaca tgcagggcgg tattgctgta 361 tctatggcag ccacactgta ggcctctcag agagcagtga ccccctggag ctggtggtga 421 caggagccta cagcaaaccc accctctcag ctctgcccag ccctgtggtg acctcaggag 481 ggaatgtgac catccagtgt gactcacagg tggcatttga tggcttcatt ctgtgtaagg 541 aaggagaaga tgaacaccca caatgcctga actcccattc ccatgcccgt gggtcatccc 601 gggccatctt ctccgtgggc cccgtgagcc caagtcgcag gtggtcgtac aggtgctatg 661 gttatgactc gcgcgctccc tatgtgtggt ctctacccag tgatctcctg gggctcctgg 721 tcccaggtgt ttctaagaag ccatcactct cagtgcagcc gggtcctgtc gtggcccctg 781 gggagaagct gaccttccag tgtggctctg atgccggcta cgacagattt gttctgtaca 841 aggagtgggg acgtgacttc ctccagcgcc ctggccggca gccccaggct gggctctccc 901 aggccaactt caccctgggc cctgtgagcc gctcctacgg gggccagtac acatgctccg 961 gtgcatacaa cctctcctcc gagtggtcgg cccccagcga ccccctggac atcctgatca 1021 caggacagat ccgtgccaga cccttcctcT CCGTGCGGCC GGGCCCCACA GTGGCCTCAG 1081 GAGAGAACGT GACCCTGCTG TGTCAGTCAC AGGGAGGGAT GCACACTTTC CTTTTGACCA 1141 AGGAGGGGGC AGCTGATTCC CCGCTGCGTC TAAAATCAAA GCGCCAATCT CATAAGTACC 1201 AGGCTGAATT CCCCATGAGT CCTGTGACCT CGGCCCACGC GGGGACCTAC AGGTGCTACG 1261 GCTCACTCAG CTCCAACCCC TACCTGCTGA CTCACCCCAG TGACCCCCTG GAGCTCGTGG 1321 TCTCAGGAGC AGCTGAGACC CTCAGCCCAC CACAAAACAA GTCCGACTCC AAGGCTGGTG 1381 AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1441 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1501 GGCTTTATAT ATCTTGTGGA AAGGACGAAG CCAAGCTCAG GCTTTGGACA CTACGCGTTA 1561 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt