Construct: ORF TRCN0000476912
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015201.1_s317c1
- Derived from:
- ccsbBroadEn_02599
- DNA Barcode:
- AATATTGCGCGCAACCGAGCATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LILRA1 (11024)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476912
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_006863.4 | 100% | 100% | |
2 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_001278319.1 | 89.7% | 89.5% | 1314T>A;1315_1316insC;1317_1318ins149 |
3 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001130917.3 | 87.5% | 79.1% | (many diffs) |
4 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526385.1 | 87.5% | 79.1% | (many diffs) |
5 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_006866.4 | 84.5% | 76.1% | (many diffs) |
6 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001278399.2 | 82.9% | 75.5% | (many diffs) |
7 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001290270.1 | 82.2% | 73.9% | (many diffs) |
8 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526387.1 | 82.2% | 73.9% | (many diffs) |
9 | human | 11026 | LILRA3 | leukocyte immunoglobulin li... | NM_006865.4 | 82.2% | 76.4% | (many diffs) |
10 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278406.2 | 81.5% | 75.3% | (many diffs) |
11 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278405.2 | 81.3% | 73.5% | (many diffs) |
12 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001290271.2 | 79.5% | 66.6% | (many diffs) |
13 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_006722986.1 | 79.5% | 66.6% | (many diffs) |
14 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526388.1 | 78.4% | 69.9% | (many diffs) |
15 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526386.1 | 77.3% | 64.5% | (many diffs) |
16 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026192.1 | 77.2% | 70.3% | (many diffs) |
17 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_005874.5 | 71.7% | 63.1% | (many diffs) |
18 | human | 11026 | LILRA3 | leukocyte immunoglobulin li... | NM_001172654.2 | 70.3% | 65.8% | (many diffs) |
19 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026191.1 | 70.2% | 63.3% | (many diffs) |
20 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526336.2 | 70% | 63% | (many diffs) |
21 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001080978.4 | 70% | 63.2% | (many diffs) |
22 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278403.2 | 70% | 63.2% | (many diffs) |
23 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NR_103503.1 | 69.8% | (many diffs) | |
24 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526335.2 | 68.8% | 61.8% | (many diffs) |
25 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001278398.2 | 68.8% | 57.6% | (many diffs) |
26 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526390.1 | 67.9% | 52.8% | (many diffs) |
27 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_935716.2 | 67.5% | (many diffs) | |
28 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081638.3 | 64.7% | 58.3% | (many diffs) |
29 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081637.2 | 64.6% | 58.2% | (many diffs) |
30 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_006669.6 | 64.5% | 58% | (many diffs) |
31 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026185.1 | 64.5% | 58% | (many diffs) |
32 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081639.3 | 64.4% | 57.9% | (many diffs) |
33 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026182.2 | 63.7% | 57.4% | (many diffs) |
34 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026183.2 | 63.6% | 57.2% | (many diffs) |
35 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526332.3 | 63.5% | 56.9% | (many diffs) |
36 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526331.2 | 63.4% | 56.9% | (many diffs) |
37 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026184.2 | 63.3% | 56.7% | (many diffs) |
38 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026188.1 | 63.1% | 56.8% | (many diffs) |
39 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026186.1 | 63% | 56.7% | (many diffs) |
40 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026187.1 | 63% | 56.7% | (many diffs) |
41 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026190.1 | 62.9% | 56.6% | (many diffs) |
42 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026189.1 | 62.8% | 56.5% | (many diffs) |
43 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NR_103502.1 | 62.7% | (many diffs) | |
44 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_017026224.1 | 61.5% | 49.8% | (many diffs) |
45 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526389.1 | 60.5% | 49.6% | (many diffs) |
46 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_001278318.2 | 59.1% | 59.1% | 659_660ins600 |
47 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278404.2 | 55% | 47.5% | (many diffs) |
48 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526391.1 | 48.7% | 35.8% | (many diffs) |
49 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NR_103518.2 | 46.2% | (many diffs) | |
50 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NR_103521.3 | 44.7% | (many diffs) | |
51 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NR_103501.2 | 42.5% | (many diffs) | |
52 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_002958244.1 | 39.6% | (many diffs) | |
53 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_001753590.2 | 39.6% | (many diffs) | |
54 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_001753591.1 | 37.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1536
- ORF length:
- 1467
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacccccatc gtcacagtcc tgatctgtct caggctgagt ctgggccccc 121 ggacccacgt gcaggcaggg accctcccca agcccacact ctgggctgag ccaggctctg 181 tgatcaccca ggggagtccc gtgaccctct ggtgtcaggg gatcctggag acccaggagt 241 accgtctgta tagagaaaag aaaacagcac cctggattac acggatccca caggagattg 301 tgaagaaggg ccagttcccc atcccatcca tcacctggga acacacaggg cggtatcgct 361 gtttctacgg tagccacact gcaggctggt cagagcccag tgaccccctg gagctggtgg 421 tgacaggagc ctacatcaaa cccaccctct cagctctacc cagccctgtg gtgacctcag 481 gagggaacgt gaccctccat tgtgtctcac aggtggcatt tggcagcttc attctgtgta 541 aggaaggaga agatgaacac ccacaatgcc tgaactcaca gccccgtacc catgggtggt 601 cccgggccat cttctctgtg ggccccgtga gcccgagtcg caggtggtcg tacaggtgct 661 atgcttatga ctcgaactct ccccatgtgt ggtctctacc cagtgatctc ctggagctcc 721 tggtcctagg tgtttctaag aagccatcac tctcagtgca gccaggtcct atagtggccc 781 ctggggagag cctgaccctc cagtgtgttt ctgatgtcag ctacgacaga tttgttctgt 841 ataaggaggg agaacgtgac ttcctccagc tccctggccc acagccccag gctgggctct 901 cccaggccaa cttcaccctg ggccctgtga gccgctccta cgggggccag tacagatgct 961 ccggtgcata caacctctcc tccgagtggt cggcccccag cgaccccctg gacatcctga 1021 tcgcaggaca gttccgtggc agacccttca tctcggtgca tccgggcccc acggtggcct 1081 caggagagaa cgtgaccctg ctgtgtcagt catgggggcc gttccacact ttccttctga 1141 ccaaggcggg agcagctgat gcccccctcc gtctcagatc aatacacgaa tatcctaagt 1201 accaggctga attccctatg agtcctgtga cctcagccca ctcggggacc tacaggtgcT 1261 ACGGCTCACT CAGCTCCAAC CCCTACCTGC TGTCTCACCC CAGTGACTCC CTGGAGCTCA 1321 TGGTCTCAGG AGCAGCTGAG ACCCTCAGCC CACCACAAAA CAAGTCCGAT TCCAAGGCTG 1381 GAGCAGCTAA CACCCTCAGC CCATCACAAA ACAAGACTGC CTCACACCCC CAGGATTACA 1441 CAGTGGAGAA TCTCATCCGC ATGGGCATAG CTGGCTTGGT CCTGGTGGTC CTCGGGATTC 1501 TGCTATTTGA GGCTCAGCAC AGCCAGAGAA GCCTCTTGCC AACTTTCTTG TACAAAGTGG 1561 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1621 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1681 AAATATTGCG CGCAACCGAG CATCTACGCG TTAAGTCgac aatcaacctc tggattacaa 1741 aatttgtgaa agatt