Transcript: Human NR_104007.1

Homo sapiens FKBP prolyl isomerase 6 pseudogene (LOC100101148), non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
LOC100101148 (100101148)
Length:
875
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104007.1
NBCI Gene record:
LOC100101148 (100101148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157112 GTTAAGTCAGAGGATGCTGGA pLKO.1 204 3UTR 100% 2.160 1.080 Y LOC541473 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13708 pDONR223 100% 34.6% None 1_132del;436_875del n/a
2 ccsbBroad304_13708 pLX_304 0% 34.6% V5 1_132del;436_875del n/a
3 TRCN0000469664 TTGCTGAACACTAGGTTCTGGTGT pLX_317 100% 34.6% V5 1_132del;436_875del n/a
4 ccsbBroadEn_10396 pDONR223 100% 31.3% None 1_132del;306_307ins90;436_875del n/a
5 ccsbBroad304_10396 pLX_304 0% 31.3% V5 1_132del;306_307ins90;436_875del n/a
6 TRCN0000472526 ATGAGTTGGTGCCATGCCCTAGTT pLX_317 100% 31.3% V5 1_132del;306_307ins90;436_875del n/a
Download CSV