Transcript: Human NR_104301.2

Homo sapiens serine hydrolase like 2 (SERHL2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SERHL2 (253190)
Length:
2000
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104301.2
NBCI Gene record:
SERHL2 (253190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075314 ACTGAAGAGCAATAGCCACTT pLKO.1 602 3UTR 100% 4.050 2.835 N SERHL2 n/a
2 TRCN0000075316 CCTGCAAAGAGGAACCACGAA pLKO.1 647 3UTR 100% 2.640 1.848 N SERHL2 n/a
3 TRCN0000075315 GCAGAGGTTACTGAAGAGCAA pLKO.1 593 3UTR 100% 2.640 1.848 N SERHL2 n/a
4 TRCN0000075317 ACGATGAAATCCACCCTCAAA pLKO.1 1530 3UTR 100% 4.950 2.970 N SERHL2 n/a
5 TRCN0000050299 CCCGAGATGGTGGATAAACTT pLKO.1 429 3UTR 100% 5.625 2.813 Y SERHL n/a
6 TRCN0000050300 CCCATATTACCTCCAGACTTT pLKO.1 302 3UTR 100% 4.950 2.475 Y SERHL n/a
7 TRCN0000050302 GTGAGTGAGATCCGAAGAGTT pLKO.1 324 3UTR 100% 4.950 2.475 Y SERHL n/a
8 TRCN0000075313 GCCTGGAACTATGAAGACCTA pLKO.1 1680 3UTR 100% 2.640 1.320 Y SERHL2 n/a
9 TRCN0000050301 CGCCGCTCTTTCTCCTGGAAT pLKO.1 463 3UTR 100% 1.650 0.825 Y SERHL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05289 pDONR223 100% 44.5% None (many diffs) n/a
2 ccsbBroad304_05289 pLX_304 0% 44.5% V5 (many diffs) n/a
3 TRCN0000478878 GCCCCCCGATTTAGATCTATGTTC pLX_317 41% 44.5% V5 (many diffs) n/a
4 ccsbBroadEn_10535 pDONR223 100% 30.3% None (many diffs) n/a
5 ccsbBroad304_10535 pLX_304 0% 30.3% V5 (many diffs) n/a
6 TRCN0000480885 GACCTATACAGCACTACCATGAGG pLX_317 72.3% 30.3% V5 (many diffs) n/a
Download CSV