Transcript: Human NR_104579.1

Homo sapiens regulator of G protein signaling 20 (RGS20), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-08-26
Taxon:
Homo sapiens (human)
Gene:
RGS20 (8601)
Length:
1567
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104579.1
NBCI Gene record:
RGS20 (8601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014306 CCATCCCAACACATATTCGAT pLKO.1 584 3UTR 100% 3.000 2.400 N RGS20 n/a
2 TRCN0000014305 GCTCAGTCATTTGACAAATTA pLKO.1 332 3UTR 100% 15.000 10.500 N RGS20 n/a
3 TRCN0000415867 CATCTTCTGCTGGAGTAATAC pLKO_005 805 3UTR 100% 13.200 9.240 N RGS20 n/a
4 TRCN0000422167 CATGAACTCTGCTGTCTATAA pLKO_005 658 3UTR 100% 13.200 9.240 N RGS20 n/a
5 TRCN0000014303 GCCAACCTAAAGAATGAATTT pLKO.1 1420 3UTR 100% 13.200 9.240 N RGS20 n/a
6 TRCN0000436652 AGAAAGCAAGGATAATCTATG pLKO_005 480 3UTR 100% 10.800 7.560 N RGS20 n/a
7 TRCN0000014304 CGGAGAAATCTATTGAAGCAT pLKO.1 699 3UTR 100% 3.000 2.100 N RGS20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11282 pDONR223 100% 37.6% None (many diffs) n/a
2 ccsbBroad304_11282 pLX_304 0% 37.6% V5 (many diffs) n/a
3 TRCN0000474168 AATTTGACGACATGACATTACAAC pLX_317 78.8% 37.6% V5 (many diffs) n/a
4 ccsbBroadEn_01965 pDONR223 100% 33.4% None 1_144del;213_214ins149;719_1567del n/a
5 ccsbBroad304_01965 pLX_304 0% 33.4% V5 1_144del;213_214ins149;719_1567del n/a
Download CSV