Transcript: Human NR_110145.1

Homo sapiens vanin 2 (VNN2), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2018-11-25
Taxon:
Homo sapiens (human)
Gene:
VNN2 (8875)
Length:
1918
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110145.1
NBCI Gene record:
VNN2 (8875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160770 CTGAAGTGCTACTTACCGAAA pLKO.1 1235 3UTR 100% 4.050 5.670 N VNN2 n/a
2 TRCN0000158893 GCAATAACTTACCTGCTAATA pLKO.1 1405 3UTR 100% 13.200 9.240 N VNN2 n/a
3 TRCN0000159142 GAAACCTTACAGTCTGTCAAA pLKO.1 977 3UTR 100% 4.950 3.465 N VNN2 n/a
4 TRCN0000161721 CGAATCATTGTGACTCCAGAA pLKO.1 345 3UTR 100% 4.050 2.835 N VNN2 n/a
5 TRCN0000159176 GAAGTGGTATTTATGCACCAA pLKO.1 737 3UTR 100% 2.640 1.848 N VNN2 n/a
6 TRCN0000158666 CCCAAGTTTACTAAGAAACTT pLKO.1 1534 3UTR 100% 0.563 0.338 N VNN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02037 pDONR223 100% 62.4% None (many diffs) n/a
2 ccsbBroad304_02037 pLX_304 0% 62.4% V5 (many diffs) n/a
3 TRCN0000468576 GCCTGTGAGGCATTAGTATCCTCG pLX_317 21.2% 62.4% V5 (many diffs) n/a
4 ccsbBroadEn_15647 pDONR223 0% 62.3% None (many diffs) n/a
5 ccsbBroad304_15647 pLX_304 0% 62.3% V5 (many diffs) n/a
6 TRCN0000472670 GGCCCATCATGTAATCAAACAACT pLX_317 31.5% 62.3% V5 (many diffs) n/a
Download CSV