Transcript: Human NR_110662.3

Homo sapiens tetratricopeptide repeat domain 25 (TTC25), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TTC25 (83538)
Length:
2713
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110662.3
NBCI Gene record:
TTC25 (83538)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423649 TCGAGTCAGCCGTGAACAATT pLKO_005 1032 3UTR 100% 13.200 18.480 N TTC25 n/a
2 TRCN0000166576 CGATGCCAACAAGGGTATCAT pLKO.1 1126 3UTR 100% 5.625 4.500 N TTC25 n/a
3 TRCN0000165673 GAGCTTCAGCAACGCTCTTTA pLKO.1 209 3UTR 100% 13.200 9.240 N TTC25 n/a
4 TRCN0000420477 TGTACACCATGGGAGACTTTG pLKO_005 379 3UTR 100% 10.800 7.560 N TTC25 n/a
5 TRCN0000161752 CAGGAGAATTAGGCACAAGAT pLKO.1 1431 3UTR 100% 4.950 3.465 N TTC25 n/a
6 TRCN0000165823 GCAACTGAATGCCAGTGTTCT pLKO.1 979 3UTR 100% 4.950 3.465 N TTC25 n/a
7 TRCN0000165274 GAGCAAAGACTCTCAGGAGAA pLKO.1 1532 3UTR 100% 4.050 2.835 N TTC25 n/a
8 TRCN0000251151 TCTATCATCGAGGCTACAAAC pLKO_005 415 3UTR 100% 10.800 7.560 N Ttc25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12739 pDONR223 100% 49.6% None (many diffs) n/a
2 ccsbBroad304_12739 pLX_304 0% 49.6% V5 (many diffs) n/a
3 TRCN0000472420 GCCCCCCCCAGCTGCCACAGACGA pLX_317 21.5% 49.6% V5 (many diffs) n/a
4 ccsbBroadEn_16019 pDONR223 0% 32.2% None 1_107del;234C>A;984_2713del n/a
5 ccsbBroad304_16019 pLX_304 0% 32.2% V5 1_107del;234C>A;984_2713del n/a
6 TRCN0000475592 TCTGGAGCACATATAGTTGACCCC pLX_317 28.2% 32.2% V5 1_107del;234C>A;984_2713del n/a
Download CSV