Transcript: Mouse NR_110980.1

Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 1C (Ppp1r1c), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r1c (75276)
Length:
2975
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110980.1
NBCI Gene record:
Ppp1r1c (75276)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_110980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105650 GCCATCTATATTGTATCACTT pLKO.1 1351 3UTR 100% 4.950 3.960 N Ppp1r1c n/a
2 TRCN0000105652 CCTTTATTCCAGAGTCAGATT pLKO.1 434 3UTR 100% 4.950 3.465 N Ppp1r1c n/a
3 TRCN0000105651 GCATCCCTTGTGATTCTCAAT pLKO.1 500 3UTR 100% 4.950 3.465 N Ppp1r1c n/a
4 TRCN0000105653 TCCCTTGTGATTCTCAATGAA pLKO.1 503 3UTR 100% 5.625 3.375 N Ppp1r1c n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2172 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481502 GGTCAACCAACAGGACACAGACGC pLX_317 98.2% 6.5% V5 (many diffs) n/a
2 ccsbBroadEn_15267 pDONR223 96.8% 6.5% None (many diffs) n/a
3 ccsbBroad304_15267 pLX_304 0% 6.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV