Transcript: Human NR_117088.1

Homo sapiens zinc finger protein 714 (ZNF714), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZNF714 (148206)
Length:
651
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_117088.1
NBCI Gene record:
ZNF714 (148206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_117088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 536 3UTR 100% 4.950 2.475 Y CFLAR n/a
2 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 536 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_117088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11384 pDONR223 100% 36.3% None (many diffs) n/a
2 ccsbBroad304_11384 pLX_304 0% 36.3% V5 (many diffs) n/a
3 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 36.3% V5 (many diffs) n/a
4 ccsbBroadEn_13746 pDONR223 100% 31.4% None (many diffs) n/a
5 ccsbBroad304_13746 pLX_304 0% 31.4% V5 (many diffs) n/a
6 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 31.4% V5 (many diffs) n/a
7 ccsbBroadEn_09784 pDONR223 100% 20.4% None (many diffs) n/a
8 ccsbBroad304_09784 pLX_304 0% 20.4% V5 (many diffs) n/a
9 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 20.4% V5 (many diffs) n/a
Download CSV