Transcript: Human NR_122071.1

Homo sapiens long intergenic non-protein coding RNA 2687 (LINC02687), long non-coding RNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
LINC02687 (399886)
Length:
2597
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_122071.1
NBCI Gene record:
LINC02687 (399886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_122071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128230 CAAGATAAGCACAGCTTTCTA pLKO.1 2033 3UTR 100% 5.625 3.938 N LINC02687 n/a
2 TRCN0000127884 GATCAGCCTACAGCCAAGATA pLKO.1 2019 3UTR 100% 5.625 3.938 N LINC02687 n/a
3 TRCN0000130214 CAGCCATCCTGTATATTGTAG pLKO.1 2093 3UTR 100% 4.950 3.465 N LINC02687 n/a
4 TRCN0000130797 GAGCCAAGATTTCCCAGATCA pLKO.1 2003 3UTR 100% 4.950 3.465 N LINC02687 n/a
5 TRCN0000130754 GAATCACTCAGCCATCCTGTA pLKO.1 2085 3UTR 100% 4.050 2.835 N LINC02687 n/a
6 TRCN0000127758 GAAGAATCACTCAGCCATCCT pLKO.1 2082 3UTR 100% 2.640 1.848 N LINC02687 n/a
7 TRCN0000139739 CCTTCTGAGTAGCTGGGATTA pLKO.1 1034 3UTR 100% 10.800 5.400 Y INAVA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_122071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10371 pDONR223 100% 19.2% None 1_70del;572_2597del n/a
2 ccsbBroad304_10371 pLX_304 0% 19.2% V5 1_70del;572_2597del n/a
3 TRCN0000481096 ATTCGGATTAGCCGATCGTACAGA pLX_317 87.4% 19.2% V5 1_70del;572_2597del n/a
4 ccsbBroadEn_15487 pDONR223 0% 6.1% None (many diffs) n/a
5 ccsbBroad304_15487 pLX_304 0% 6.1% V5 (many diffs) n/a
6 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 6.1% V5 (many diffs) n/a
Download CSV