Transcript: Human NR_123724.2

Homo sapiens proliferation and apoptosis adaptor protein 15 (PEA15), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PEA15 (8682)
Length:
2246
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_123724.2
NBCI Gene record:
PEA15 (8682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_123724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059391 CCAAGAAGTACAAAGACATTA pLKO.1 281 3UTR 100% 13.200 9.240 N PEA15 n/a
2 TRCN0000286681 CCAAGAAGTACAAAGACATTA pLKO_005 281 3UTR 100% 13.200 9.240 N PEA15 n/a
3 TRCN0000294023 CTGAGGAAGAGATCATCAAAT pLKO_005 314 3UTR 100% 13.200 9.240 N PEA15 n/a
4 TRCN0000059388 GCAGAATCAAATTGCTACATA pLKO.1 1601 3UTR 100% 5.625 3.938 N PEA15 n/a
5 TRCN0000059389 CCTCTCCTACATTGAGCACAT pLKO.1 144 3UTR 100% 4.050 2.835 N PEA15 n/a
6 TRCN0000286682 CCTCTCCTACATTGAGCACAT pLKO_005 144 3UTR 100% 4.050 2.835 N PEA15 n/a
7 TRCN0000105788 CTATGGTGGTTGACTACAGAA pLKO.1 197 3UTR 100% 4.950 2.970 N Pea15a n/a
8 TRCN0000307569 ACACCAAGCTAACCCGTATTC pLKO_005 254 3UTR 100% 10.800 15.120 N Pea15a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_123724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01989 pDONR223 100% 12.6% None (many diffs) n/a
2 ccsbBroad304_01989 pLX_304 0% 12.6% V5 (many diffs) n/a
3 TRCN0000465411 GTCTAATCTTTCATAAAAATGCCG pLX_317 93.1% 12.6% V5 (many diffs) n/a
4 ccsbBroadEn_07284 pDONR223 100% 12.5% None (many diffs) n/a
5 ccsbBroadEn_11293 pDONR223 100% 9.8% None 1_1489del;1712_2246del n/a
6 ccsbBroad304_11293 pLX_304 0% 9.8% V5 1_1489del;1712_2246del n/a
7 TRCN0000468083 GTTGCCGCCCGCTGCGTATAACAG pLX_317 100% 9.8% V5 1_1489del;1712_2246del n/a
Download CSV