Transcript: Human NR_126166.1

Homo sapiens family with sequence similarity 74 member A7 (FAM74A7), long non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
FAM74A7 (100996582)
Length:
1893
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126166.1
NBCI Gene record:
FAM74A7 (100996582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_126166.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160588 CACATGCTTATGGCAATAAAT pLKO.1 1426 3UTR 100% 15.000 7.500 Y FAM74A4 n/a
2 TRCN0000269736 TCACAGTCAAGCACCTATTTA pLKO_005 761 3UTR 100% 15.000 7.500 Y FAM74A3 n/a
3 TRCN0000269737 CAGTCTCCCACATCCGAAATT pLKO_005 840 3UTR 100% 13.200 6.600 Y FAM74A3 n/a
4 TRCN0000269739 TCCTTAAGTAAGTCATATTTG pLKO_005 795 3UTR 100% 13.200 6.600 Y FAM74A3 n/a
5 TRCN0000269801 AGACATGGAGAGAGCTCAAAG pLKO_005 630 3UTR 100% 10.800 5.400 Y FAM74A3 n/a
6 TRCN0000164676 CAAAGGCTGTCCACAAGAAGA pLKO.1 646 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
7 TRCN0000164861 CAAGAAGACGTGCAGAGAGTT pLKO.1 591 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
8 TRCN0000164049 CAAGAAGATGTGGAGAGAGTT pLKO.1 659 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
9 TRCN0000162379 CAGGTGTTAAATCACAGTCAA pLKO.1 750 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
10 TRCN0000167598 GATACTACTTTCTAGCTAGAA pLKO.1 1499 3UTR 100% 4.950 2.475 Y FAM74A1 n/a
11 TRCN0000164885 GCTGAGGCAGAAGAATCACTT pLKO.1 1087 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
12 TRCN0000164913 GAAGACATGGAGAGAGCTCAA pLKO.1 628 3UTR 100% 4.050 2.025 Y FAM74A4 n/a
13 TRCN0000162930 GCACCTATTTACCTAGTGGTA pLKO.1 771 3UTR 100% 2.640 1.320 Y FAM74A4 n/a
14 TRCN0000166562 CCACAAGAAGATGTGGAGAGA pLKO.1 656 3UTR 100% 0.264 0.132 Y FAM74A4 n/a
15 TRCN0000165905 GACGTGGAAAGAGCTCAGAAA pLKO.1 521 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126166.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10380 pDONR223 100% 19.8% None (many diffs) n/a
2 ccsbBroad304_10380 pLX_304 0% 19.8% V5 (many diffs) n/a
3 TRCN0000466037 CTTAATCTAACAGAATCTTCCCAA pLX_317 76.9% 19.8% V5 (many diffs) n/a
4 ccsbBroadEn_16168 pDONR223 0% 19.1% None (many diffs) n/a
5 ccsbBroad304_16168 pLX_304 0% 19.1% V5 (many diffs) n/a
6 ccsbBroadEn_15326 pDONR223 86.4% 18.7% None (many diffs) n/a
Download CSV