Transcript: Human NR_130117.2

Homo sapiens poly(ADP-ribose) polymerase family member 12 (PARP12), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
PARP12 (64761)
Length:
2879
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130117.2
NBCI Gene record:
PARP12 (64761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434136 CAGAGTTTCTAGATACAATTT pLKO_005 2363 3UTR 100% 13.200 18.480 N PARP12 n/a
2 TRCN0000427162 GCTCCATATCTGCCAGTATTT pLKO_005 635 3UTR 100% 13.200 10.560 N PARP12 n/a
3 TRCN0000004615 CGAAGAGCATCCCAGACTATT pLKO.1 1404 3UTR 100% 13.200 9.240 N PARP12 n/a
4 TRCN0000004616 CCATAGAGTTCATTTCCATTT pLKO.1 974 3UTR 100% 10.800 7.560 N PARP12 n/a
5 TRCN0000004614 CCGGGAAGAACTGTAGGAATA pLKO.1 427 3UTR 100% 10.800 7.560 N PARP12 n/a
6 TRCN0000427104 TCAGATCTGTTTGTACCATAT pLKO_005 923 3UTR 100% 10.800 7.560 N PARP12 n/a
7 TRCN0000004618 CCTGGTCTATGGCACAACTAA pLKO.1 1303 3UTR 100% 5.625 3.938 N PARP12 n/a
8 TRCN0000004617 TGATTGTAGTTGAGTCCAGTT pLKO.1 2270 3UTR 100% 4.050 2.835 N PARP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08865 pDONR223 100% 64.8% None (many diffs) n/a
2 ccsbBroad304_08865 pLX_304 0% 64.8% V5 (many diffs) n/a
3 TRCN0000480637 ACACCTCCTAATTTATCATGCCTT pLX_317 16.2% 64.8% V5 (many diffs) n/a
Download CSV